This study was carried out as a case-control study to evaluate the relative mRNA expression of CTLA-4, PTPN-22 and IL-37 genes among SLE patients, with and without nephritis, and healthy controls. The patients were recruited from the inpatient and outpatient of Physical Medicine, Rheumatology and Rehabilitation department as well as the Nephrology department of Suez Canal University Hospital. Laboratory tests and molecular biology techniques were done in Medical Biochemistry and Molecular Biology department, Oncology Diagnostic Unit Lab, and the clinical pathology department at Suez Canal University. The sample size was calculated to meet the statistical requirement with a 95% confidence level according to the mean prevalence of SLE worldwide and also the proportion of LN in SLE disease.

The study population was classified into two groups; fifty-eight SLE patients, diagnosed according to the American College of Rheumatology (ACR) revised updated criteria for the classification of SLE12 versus 50 age and gender matched healthy controls. In both groups, the age of the participants was more than 16 years old. The patients with other autoimmune diseases as (Rheumatoid arthritis, Spondyloarthropathies, Dermatomyositis, polymyositis, Sarcoidosis and Systemic sclerosis) were excluded.

The participants underwent careful medical history and examination. The SLE group was further classified into two groups: twenty-nine patients with lupus nephritis and 29 SLE patients without nephritis. Lupus nephritis was defined when the SLE patient had proteinuria more than 0.5g per day. Disease activity was assessed using the SLE Disease Activity Index (SLEDAI).13

All participants enrolled in the study signed informed consent, according to the regulations of the research ethics committee of the Faculty of Medicine, Suez Canal University, approval letter ID: 4311.

Laboratory assessment was done in the form of complete blood count (CBC) (Sysmex XT 5 parts differential cell counter, Germany),serum creatinine, 24-hrs protein, c-reactive protein (CRP), complement (C3&C4) levels by (COBAS e411 Roche Diagnostics, Germany), and erythrocyte sedimentation rate (ESR) by the Westergren method. Assessment of antinuclear antibodies (ANA) by (Bio-Rad, HEp-2 cells immunofluorescence assay)and dsDNA antibodies were measured by enzyme-linked immunosorbent assay (ELISA).

Fresh whole blood samples were collected in EDTA coated tubes from all the patients and healthy controls to extract total RNA from peripheral blood mononuclear cells (PBMC) with Trizol according to the manufacturer's instructions of the QIAamp RNA Blood Mini Kit (Qiagen, Hilden, Germany, cat. No.52304). NanoDrop ND-1000 spectrophotometer (NanoDrop Tech., Inc. Wilmington, DE, USA) was used to assess the quantity and quality of RNA as well as cDNA. On the thermocycler (Robocycler Gradient 96, BIOMETRA®, LA, USA), reverse transcription was performed with the High-Capacity cDNA Reverse Transcription Kit (Invitrogen/Life Technologies, USA, cat. No. Archive). The relative mRNA expression levels of CTLA-4, IL-37 and PTPN-22 were assessed by StepOne™ Real-Time PCR System (Applied Biosystem) by using Maxima SYBR Green qPCR master mix (Thermofisher Scientific, USA, cat. No. K0251) and genes’ specific primer assays (willowfort, UK) that have been designed by us: primer nucleotide sequence is used in Real-time PCR as Forward primer Sequence for CTLA-4 was 5′TGGCTTGCCTTGGATTTCAGC3′ and Reverse primer Sequence was 5′ACACACAAAGCTGGCGATGC3′, IL-37 Forward primer Sequence was 5′GATCACAAAGTACTGGTCCTGG3′ and Reverse primer Sequence was 5′TCCTTTATCCTTGTCACAGTAG3′, PTPN22Forward primer Sequence was 5′CTGTACTAGCAACTGCTCCA3′, Reverse primer Sequence was 5’TCCAGCTTCCTCAACCACAA3’ and GAPDH Forward primer Sequence was 5′CTCCTCACAGTTGCCATGTA3′, and Reverse primer Sequence 5′GTTGAGCACAGGGTACTTTATTG3 with thermal cycling protocol: initial denaturation for 10min at 95°C then forty cycles of denaturation at 95°C for15s, Annealing at 56°C for 30s and extension at 72°C for 30s followed by a melting curve analysis to exclude primer dimer. GAPDH was used as an internal reference. The results were expressed as 2−ΔΔCT.14 The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were followed for all PCR reactions.15

The data was analyzed using SPSS.25 software (SPSS Inc., Chicago, IL, USA). The data was presented as frequency and percentages for qualitative variables and as mean and standard deviation for quantitative variables. Chi-square test was used to compare categorical variables and t-test was used for quantitative variables. Spearman correlation coefficient test was used to evaluate the correlation of the relative mRNA expression of CTLA-4, PTPN22 and IL-37 with different variables. Regression analysis and Odds ratio were done to detect the ability of relative CTLA-4, PTPN-22, and IL-37 mRNA expressions to predict LN in SLE disease.

Demographic, clinical and laboratory data of SLE patients are shown in Table 1. The mean age of SLE patients was 31.67±9.27 years, 94.8% were females and the mean of the disease duration was 7.12±5.15 years. Other clinical parameters including disease activity and treatment taken were also listed. The laboratory characteristics of SLE patients revealed that almost all of them (91.4%) were ANA positive, and roughly 60% were anti-dsDNA positive, with elevated ESR (52.7731.44mm/h) and low hemoglobin level (10.71.2g/dl). TLC, Platelets, creatinine, C3 and C4 were also listed. Demographic, clinical, and laboratory data of the SLE without nephritis versus SLE with nephritis are demonstrated in Table 2.

Concerning, the relative mRNA expression levels of CTLA4, PTPN22, IL-37 genes in SLE patients versus the healthy controls, as shown in Fig. 1. It was found that there was a significantly higher mRNA expression of CTLA-4 and IL-37 in SLE patients than in the healthy control group. The mean fold change of CTLA-4 gene expression was 2.380±2.138 (p=0.005) and the mean fold change of IL-37 gene expression was 1.915±1.687 (p=0.018). While there was a non-significant difference in PTPN22 gene expression in SLE patients versus the healthy control group as the mean fold change of PTPN22 gene expression was 1.088±0.817 (p=0.631).

Fig. 1.

CTLA-4, IL-37 and PTPN22 gene expression in SLE patients versus controls. There were significantly higher expression of CTLA-4 and IL-37 in SLE patients compared to control (p=0.005, and p=0.018, respectively). On the other hand, there was a non-significant difference in PTPN22 expression in SLE patients versus controls (p=0.631).

(0.1MB).

Regarding, the relative mRNA expression of CTLA4, PTPN22, IL-37 genes in SLE patients with nephritis versus SLE patients without nephritis, the relative expression of IL-37 showed a significant increase in SLE patients with LN and the fold change was greater up to 3 fold up-regulated in LN patients (2.60±1.63) versus SLE patients without nephritis (1.22±1.06, p=0.001). There was a significant decrease in the relative mRNA expression of CTLA-4 in LN patients in comparison to SLE patients without nephritis and the fold change was (1.81±1.69) in LN patients versus (2.94±2.40) in SLE patients without nephritis (p=0.044). However, there was a non-significant difference in the relative mRNA expression of PTPN-22 between both groups as the fold change was (1.23±0.81) in LN patients versus (0.94±0.70) in SLE patients without nephritis, (p=0.172) (Fig. 2).

Fig. 2.

Association of relative CTLA-4, IL-37 and PTPN22 mRNA gene expression in SLE patients with lupus nephritis (LN) versus without lupus nephritis (LN). (A) There was a significant decrease in the relative expression of CTLA-4 in SLE patients with LN in comparison to SLE patients without LN (p=0.044). (B) There was a non-significant difference in PTPN22 expression in SLE patients with and without LN (p=0.172). (C) There was significantly higher expression of IL-37 in SLE patients with lupus nephritis compared to those without lupus nephritis (p=0.001).

(0.2MB).

We evaluated the correlation of the relative mRNA expression of CTLA-4, PTPN-22 and IL-37 genes with some clinical and laboratory parameters in SLE patients, as presented in Table 3. The correlation analysis of genes expression with disease activity was performed. There was a significant positive correlation of PTPN22 and IL-37 with SLE disease activity (r=0.272, p=0.039; r=0.324, p=0.013 respectively). In addition, there was a significant negative correlation of IL-37 with low C3 level (r=0.260, p=0.049). But CTLA-4 expression was not correlated with any of the SLE studied parameters.

Moreover, the correlation analysis of the relative mRNA expression among the studied genes with each other was also done. There was only a significant positive correlation between the relative mRNA expression of PTPN22 and IL-37 in SLE patients (r=0.289 and p=0.028) (Fig. 3).

Fig. 3.

correlation of the relative expression of PTPN22 with IL-37 in SLE patients. The relative mRNA expression of PTPN-22 gene showed a significant positive correlation with IL-37 gene expression (r=0.289, p=0.027).

(0.1MB).

Over-expression of IL-37 was associated with an increased likelihood of exhibiting lupus nephritis. Patients with relative IL-37 mRNA over-expression have twice likelihood to exhibit lupus nephritis (OR=1.906, 95% CI=1.218–2.983, p=0.005). On the other hand, CTLA-4 and PTPN-22 were not associated with increased likelihood of developing lupus nephritis (OR=0.755, the 95% CI=0.567–1.006, p=0.055; OR=1.084, the 95% CI=0.510–2.301, p=0.834 respectively), as presented in Table 4.

Relative CTLA-4 mRNA expression was significantly elevated in our SLE studied patients. The level of serum soluble CTLA-4 (sCTLA-4) was found to be increased in SLE patients,18 however, there were no significant correlations between CTLA-4 gene expression and any laboratory markers or disease activity in our SLE study patients. According to that CTLA-4 may not affect exacerbations of SLE activity. Furthermore, PTPN-22 gene expression in the SLE patients showed a non-significant difference from control, but it had a significant positive correlation with disease activity. In contrast to our study results, it was reported that the level of PTPN-22 was higher in the SLE group in comparison to healthy controls.9 However, Machado-Contreras et al. found that PTPN-22 mRNA expression was reduced or absent in SLE patients who had a severe flare, and they concluded that there was no link between PTPN22 and the development of SLE in a Mexican population.19

Concerning relative IL-37 gene expression in this study, it was significantly higher in SLE patients than in control groups. Moreover, it had a significant positive correlation with low C3. Wu et al. showed that the level of C3 was positively associated with plasma IL-37 levels in SLE patients.20

Additionally, IL-37 gene expression in our SLE patients had a significant positive correlation with SLE activity. Many studies confirmed that IL-37 mRNAs expressions and serum protein levels were higher in patients with SLE than in controls and that IL-37 mRNAs and protein levels were significantly higher in patients with active diseases.10,11 Ye et al. suggested that IL-37 was associated with SLE disease activity because its anti-inflammatory effects were enhanced in the inflammatory phase and active state only. Nold et al. reported, IL-37 inhibited P38MARK phosphorylation which resulted in decreasing serum levels of pro-inflammatory cytokines and tissue damage in SLE disease.21

CTLA-4 gene expression was significantly lower among SLE patients with LN than in those without LN, the lower relative expression of CTLA-4 gene may be associated with inflammation in the kidney causing nephritis. In addition, a study conducted by Grywalska et al., confirmed that the low CTLA-4 expression and low serum level of sCTLA-4 may lead to continuous activation of T-cells causing glomerular inflammation and injury. Also, the anti-CTLA-4 monoclonal antibody (ipilimumab) that was used by oncology patients, was associated with the development of various glomerular pathologies.22

Huang et al. revealed that CTLA-4-Immunoglobulin combined with dendritic cells could have potential therapeutic effect to enhance immune tolerance and promote life quality of patients with SLE.23

Whereas there was a non-significant difference in PTPN-22 gene expression in SLE patients with LN compared to those without LN. A study by Orozco et al. discovered no significant differences in the distribution of PTPN-22 1858CT genotypes between SLE patients with and without LN.24 Another study, however, has shown that the PTPN-22 1858 C/T SNP polymorphism is associated with an increased risk of nephritis in SLE patients.25 Tizaoui et al. demonstrated that PTPN-22 have an important role in autoimmune diseases and give insights into these disease mechanisms and could be an attractive therapeutic target of several autoimmune diseases. According to the role of PTPN-22 in stimulation of T and B cells, antagonizing the effect of PTPN22 could be a novel chance to develop a proper treatment for patients with autoimmune disease as auto-reactive B and T cells inhibition is essential.26

Alternatively, in this study, there was a significantly higher IL-37 expression in LN patients compared to those without LN, also regression analysis proved that the higher IL-37 expression is considered as a significant predictor marker for the development of LN. Tawfik et al. confirmed the same results, that the serum level of IL-37 in SLE patients was higher among lupus nephritis patients.11 Moreover, Yang Y et al. detected that Small interfering RNA smashed of IL-37 in PBMCs of human renal tubular epithelial cells inhibits the kidney expression of inflammatory cytokines IL-6, TNF-α and IL-1β.27

Interestingly, a study by Ding L et al., proved that IL-37 has a protective effect in the kidney among lupus nephritis mice by reducing the deposition of the autoimmune complex as IgM, IgG, and C3, so lowering the production of inflammatory cytokines like IL-17 and IL-6 and increasing the anti-inflammatory cytokines like IL-10 and TGFβ-3, also increases the frequency of Treg cells and reduces the frequency of Th17 cells.28 Regarding other cytokines expression in SLE patients, it was interesting to show that IL-36α is significantly more expressed in Egyptian SLE patients compared to healthy controls and correlated with SLE disease activity and arthritis.29

The potentiated therapeutic effect of IL-37 is the inhibitory influence on the inflammatory microenvironment. Therefore, Genetic modification to overexpress IL-37 may enhance the therapeutic effects.30

It should be noted, PTPN-22 gene expression showed a significant positive correlation with IL-37 gene expression and up to our best knowledge, we considered ourself the first study to shed light on this correlation. Both genes have the same protective and suppressive role against the over-activity of the immune system. More studies are needed to confirm this correlation and other linked genes that communicate with both genes.

To the best of our knowledge, this study is the first to investigate the expression and interplay among CTLA-4, PTPN-22, and IL-37 genes in Egyptian SLE patients. Furthermore, the key strengths of the study included the in-depth analysis of CTLA-4, PTPN-22, and IL-37 genes expression with disease activity and renal involvement and shed light on the molecular role of these three genes in the pathogenesis and prognosis and also could represent useful biomarkers of SLE. However, it would be interesting to investigate these genes in further prospective cohort studies with large sample sizes to confirm our results in Egyptian SLE patients and establish the role of CTLA-4, PTPN-22, and IL-37 genes in the pathogenesis of SLE disease.