array:22 [
  "pii" => "S1699258X18301244"
  "issn" => "1699258X"
  "doi" => "10.1016/j.reuma.2018.06.006"
  "estado" => "S300"
  "fechaPublicacion" => "2020-05-01"
  "aid" => "1241"
  "copyrightAnyo" => "2018"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Reumatol Clin. 2020;16:229-34"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 238
    "formatos" => array:3 [
      "EPUB" => 29
      "HTML" => 89
      "PDF" => 120
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S1699258X18301220"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2018.06.004"
    "estado" => "S300"
    "fechaPublicacion" => "2020-05-01"
    "aid" => "1239"
    "copyright" => "Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología"
    "documento" => "simple-article"
    "crossmark" => 1
    "subdocumento" => "crp"
    "cita" => "Reumatol Clin. 2020;16:235-8"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 326
      "formatos" => array:3 [
        "EPUB" => 40
        "HTML" => 166
        "PDF" => 120
      ]
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Brief Report</span>"
      "titulo" => "Elderly-onset sarcoidosis&#58; A single center comparative study"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "235"
          "paginaFinal" => "238"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Estudio comparativo entre la sarcoidosis de inicio en la edad adulta y en la tercera edad&#46; An&#225;lisis de 131 casos"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Senol Kobak, Fidan Yildiz, Huseyin Semiz, Mehmet Orman"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Senol"
              "apellidos" => "Kobak"
            ]
            1 => array:2 [
              "nombre" => "Fidan"
              "apellidos" => "Yildiz"
            ]
            2 => array:2 [
              "nombre" => "Huseyin"
              "apellidos" => "Semiz"
            ]
            3 => array:2 [
              "nombre" => "Mehmet"
              "apellidos" => "Orman"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X18301220?idApp=UINPBA00004M"
    "url" => "/1699258X/0000001600000003/v1_202006131050/S1699258X18301220/v1_202006131050/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1699258X18301256"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2018.06.007"
    "estado" => "S300"
    "fechaPublicacion" => "2020-05-01"
    "aid" => "1242"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46; and Sociedad Espa&#241;ola de Reumatolog&#237;a y Colegio Mexicano de Reumatolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Reumatol Clin. 2020;16:222-8"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 690
      "formatos" => array:3 [
        "EPUB" => 38
        "HTML" => 466
        "PDF" => 186
      ]
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "Eficacia y seguridad de los glucocorticoides en la artritis reumatoide&#58; revisi&#243;n sistem&#225;tica de la literatura"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "222"
          "paginaFinal" => "228"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Efficacy and safety of glucocorticoids in rheumatoid arthritis&#58; Systematic literature review"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Figura 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1001
              "Ancho" => 1544
              "Tamanyo" => 100506
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Diagrama de flujo de los estudios&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Raimon Sanmart&#237;, Jes&#250;s Tornero, Javier Narv&#225;ez, Alejandro Mu&#241;oz, Elena Garmendia, Ana M&#46; Ortiz, Miguel Angel Abad, Patricia Moya, Mar&#237;a Lourdes Mateo, Delia Reina, Juan Salvatierra-Ossorio, Sergio Rodriguez, Natalia Palmou-Fontana, Ana Ruibal-Escribano, Jaime Calvo-Al&#233;n"
          "autores" => array:15 [
            0 => array:2 [
              "nombre" => "Raimon"
              "apellidos" => "Sanmart&#237;"
            ]
            1 => array:2 [
              "nombre" => "Jes&#250;s"
              "apellidos" => "Tornero"
            ]
            2 => array:2 [
              "nombre" => "Javier"
              "apellidos" => "Narv&#225;ez"
            ]
            3 => array:2 [
              "nombre" => "Alejandro"
              "apellidos" => "Mu&#241;oz"
            ]
            4 => array:2 [
              "nombre" => "Elena"
              "apellidos" => "Garmendia"
            ]
            5 => array:2 [
              "nombre" => "Ana M&#46;"
              "apellidos" => "Ortiz"
            ]
            6 => array:2 [
              "nombre" => "Miguel Angel"
              "apellidos" => "Abad"
            ]
            7 => array:2 [
              "nombre" => "Patricia"
              "apellidos" => "Moya"
            ]
            8 => array:2 [
              "nombre" => "Mar&#237;a Lourdes"
              "apellidos" => "Mateo"
            ]
            9 => array:2 [
              "nombre" => "Delia"
              "apellidos" => "Reina"
            ]
            10 => array:2 [
              "nombre" => "Juan"
              "apellidos" => "Salvatierra-Ossorio"
            ]
            11 => array:2 [
              "nombre" => "Sergio"
              "apellidos" => "Rodriguez"
            ]
            12 => array:2 [
              "nombre" => "Natalia"
              "apellidos" => "Palmou-Fontana"
            ]
            13 => array:2 [
              "nombre" => "Ana"
              "apellidos" => "Ruibal-Escribano"
            ]
            14 => array:2 [
              "nombre" => "Jaime"
              "apellidos" => "Calvo-Al&#233;n"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2173574319301169"
        "doi" => "10.1016/j.reumae.2018.06.004"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574319301169?idApp=UINPBA00004M"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X18301256?idApp=UINPBA00004M"
    "url" => "/1699258X/0000001600000003/v1_202006131050/S1699258X18301256/v1_202006131050/es/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "Methylation status of interleukin-6 gene promoter in patients with Beh&#231;et&#39;s disease"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "229"
        "paginaFinal" => "234"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Shahriar Alipour, Ebrahim Sakhinia, Alireza Khabbazi, Nasser Samadi, Zohreh Babaloo, Mahdi Azad, Somayeh Abolhasani, Jafar Farhadi, Golamreza Jadideslam, Neda Roshanravan, Mohammad Nouri"
        "autores" => array:11 [
          0 => array:3 [
            "nombre" => "Shahriar"
            "apellidos" => "Alipour"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Ebrahim"
            "apellidos" => "Sakhinia"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Alireza"
            "apellidos" => "Khabbazi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Nasser"
            "apellidos" => "Samadi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Zohreh"
            "apellidos" => "Babaloo"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Mahdi"
            "apellidos" => "Azad"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0030"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Somayeh"
            "apellidos" => "Abolhasani"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">g</span>"
                "identificador" => "aff0035"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Jafar"
            "apellidos" => "Farhadi"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          8 => array:3 [
            "nombre" => "Golamreza"
            "apellidos" => "Jadideslam"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          9 => array:3 [
            "nombre" => "Neda"
            "apellidos" => "Roshanravan"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">h</span>"
                "identificador" => "aff0040"
              ]
            ]
          ]
          10 => array:4 [
            "nombre" => "Mohammad"
            "apellidos" => "Nouri"
            "email" => array:1 [
              0 => "nourimd@yahoo.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:8 [
          0 => array:3 [
            "entidad" => "Molecular Medicine&#44; Faculty of Advanced Medical Sciences&#44; Tabriz University of Medical Sciences&#44; Iran"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Connective Tissue Diseases Research Center&#44; Tabriz University of Medical Science&#44; Iran"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Biochemistry&#44; Faculty of Medicine&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Cancer Biochemistry&#44; Cancer Biotechnology&#44; Faculty of Medicine&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Department of Immunology Medicine Faculty&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
          5 => array:3 [
            "entidad" => "Department of Medical Laboratory Sciences&#44; Faculty of Allied Medicine&#44; Qazvin University of Medical Sciences&#44; Qazvin&#44; Iran"
            "etiqueta" => "f"
            "identificador" => "aff0030"
          ]
          6 => array:3 [
            "entidad" => "Faculty of Dentistry&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "g"
            "identificador" => "aff0035"
          ]
          7 => array:3 [
            "entidad" => "Cardiovascular Research Center&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "h"
            "identificador" => "aff0040"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Estatus de la metilaci&#243;n del promotor del gen interleucina-6 en pacientes con s&#237;ndrome de Beh&#231;et"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1083
            "Ancho" => 1530
            "Tamanyo" => 45647
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Change fold of IL-6 methylation&#46; As shown in the chart&#44; the level of interleukin-6 methylation in the patient group is significantly lower than the healthy group&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Behcet&#39;s is an autoinflammatory disease that is defined by Hulusi Behcet in 1937 as an inflammatory process of unknown etiology&#44; characterized by recurrent aphthous stomatitis&#44; uveitis&#44; genital ulcers&#44; and skin lesions&#46;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">1</span></a> Although Beh&#231;et&#39;s disease &#40;BD&#41; is an extensive and worldwide disease in different parts of the world&#44; it has remarkable local differences&#44; with the maximum of incidences in the Mediterranean&#44; the Middle East&#44; and the Far East which was locally called the Silk Road&#46; Most prevalence of Beh&#231;et&#39;s disease has been reported in Turkey including 421 people per 10<span class="elsevierStyleSup">5</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">2</span></a> Among all genetic factors&#44; HLA-B51 has been confirmed as the strongest risk factor for BD&#44; which was verified in various populations&#46; More recently studies have disclosed the association of many non-HLA genes with the BD&#44; such as chemokine receptor 1 &#40;CCR1&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">3</span></a> Vitamin D Receptor &#40;VDR&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">4</span></a> interleukin-23 &#40;IL-23&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">5</span></a> IL-23R and IL-12RB2&#44;<a class="elsevierStyleCrossRefs" href="#bib0215"><span class="elsevierStyleSup">3&#44;6</span></a> fork head box P3 &#40;Foxp3&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">7</span></a> IL-2&#44; IL-4&#44; transforming growth factor &#40;TGF&#41;-beta&#44;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">8</span></a> IL-27<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">9</span></a> and IL-6<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">10</span></a> for BD&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">IL-6 is a multifunctional cytokine with a wide-range of biologic activities such as the regulation of the acute-phase response to infection&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">11</span></a> Dysregulation and dysfunction of IL-6 gene expression contributes to the inception of numerous diseases&#44; such as several types of cancer&#44; autoimmune disease for example rheumatoid arthritis &#40;RA&#41;&#44; type 1 diabetes &#40;T1D&#41;&#44; inflammatory bowel disease &#40;IBD&#41;&#44; multiple sclerosis &#40;MS&#41;&#44; and autoinflammatory disorders such as Beh&#231;et&#39;s disease &#40;BD&#41;&#46;<a class="elsevierStyleCrossRefs" href="#bib0255"><span class="elsevierStyleSup">11&#44;12</span></a> According to previous studies&#44; it was found that IL-6 exerts its action via the activation of the JAK&#47;STAT &#40;Janus kinase&#47;signal transducer and activator of transcription&#41; and MAPK &#40;mitogenactivated protein kinase&#41; cascades&#46;<a class="elsevierStyleCrossRefs" href="#bib0255"><span class="elsevierStyleSup">11&#44;13</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">Previous studies have found four types of epigenetic mechanisms&#44; which are responsible for regulating the expression of genes including&#58; DNA methylation&#44; histone modification&#44; non-coding RNAs &#40;nc RNAs&#41; and chromatin remodeling&#46;<a class="elsevierStyleCrossRefs" href="#bib0270"><span class="elsevierStyleSup">14&#8211;16</span></a> DNA methylation is an epigenetic alteration that efficiently controls gene expression via gene silencing&#44; and may significantly contribute to the risks of many multiplex diseases&#44; including cancer&#44; autoimmune disease&#44; and metabolic disorders&#46;<a class="elsevierStyleCrossRefs" href="#bib0280"><span class="elsevierStyleSup">16&#8211;18</span></a> Recent researches of cytokine&#39;s gene expression have focused on the epigenetic alterations&#44; because the DNA methylation status at CpG sites is often related with cytokine expression changes&#46;<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">19</span></a> Decreasing of methylation is related with chromatin&#39;s open position&#44; but increasing of methylation corresponds to chromatin&#39;s closed status&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">20</span></a> Then&#44; the extent to which CpG islands methylation is associated with the level of cytokine expression&#46; Thus&#44; we questioned whether DNA methylation of IL-6 is reduced in BD T cells with modifying transcription factor recruitment&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">Proinflammatory and anti-inflammatory agents are involved in the beginning and development of BD&#59; thus&#44; a comprehensive survey of the regulatory mechanism for the production of cytokines during the progression of BD is the most importance challenge&#46; IL-6 produced mainly by monocytes&#44; B cells&#44; T helper type 2 &#40;Th2&#41; and endothelial cells and plays an essential role in encouraging inflammation and stimulating the immune response&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">21</span></a> Also&#44; the production of IL-6 in the joint tissues is usually done in response to interleukin-1 beta &#40;IL-1&#946;&#41; and tumor necrosis factor alpha &#40;TNF-&#945;&#41; and is mostly performed by chondrocytes&#44; osteoblasts&#44; macrophages&#44; and adipocytes&#46;<a class="elsevierStyleCrossRefs" href="#bib0310"><span class="elsevierStyleSup">22&#44;23</span></a> Also&#44; IL-6 is an important cytokine in BD pathogenesis as well as it plays a key role in differentiation of CD4&#43; T cells to Th17 cells&#46;<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">24</span></a> IL-6 is an inflammatory cytokine that has been associated in several immune-mediated inflammatory diseases&#46;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">25</span></a> IL-6 can encourage inflammation by increasing the production of inflammatory cytokines such as TNF-&#945;&#44; IL-1&#946; and other agents&#46; In addition&#44; this cytokine plays a key role by inhibiting the anti-inflammatory cytokines and interleukin-1 receptor antagonists &#40;IL-1Ra&#41; production&#46;<a class="elsevierStyleCrossRefs" href="#bib0330"><span class="elsevierStyleSup">26&#44;27</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">Evidence has indicated that IL-6 is involved in the pathogenesis of autoimmune disease&#46; In this study&#44; we analyzed the IL-6 expression in patient with BD in comparison with healthy groups&#46; Also&#44; we evaluated the methylation level of interleukin-6 in both healthy and patient groups&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Methods and materials</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Patients and healthy controls study group</span><p id="par0030" class="elsevierStylePara elsevierViewall">All specimens presented their written informed agreement for this study&#44; and the study protocol was permitted by the ethics committee of Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran &#40;Permit Number&#58; TBZMED&#46;REC&#46;1394&#46;640&#41;&#46; The study group consisted of 51 Iranian patients with BD &#40;61&#46;7&#37; men and 38&#46;3&#37; women&#41;&#44; range 16&#8211;60 years and 61 healthy candidates&#46; The analysis of BD was based on the international study group criteria for BD&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">28</span></a> Features of the patients were evaluated at the time of diagnosis&#46; The control group composed of 61 healthy subjects who were matched with age&#44; gender&#44; and ethnic of patients &#40;59&#37; men versus 41&#37; women&#41;&#46; Healthy participants had no clinical or laboratory signs of autoimmune or inflammatory diseases&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">DNA&#44; RNA isolation and RT-PCR method</span><p id="par0035" class="elsevierStylePara elsevierViewall">Peripheral blood mononuclear cells &#40;PBMCs&#41; were extracted from EDTA blood tubes by Ficoll &#40;Lymphodex&#44; Inno -Train&#44; Germany&#41; density-gradient centrifugation and directly stored at &#8722;80<span class="elsevierStyleHsp" style=""></span>&#176;C until use&#46; Genomic DNA samples of BD and healthy controls were isolated by using the rapid genomic DNA extraction &#40;RGDE&#41; method from the peripheral blood collected in tubes containing EDTA&#46;<a class="elsevierStyleCrossRef" href="#bib0345"><span class="elsevierStyleSup">29</span></a> Total RNA was extracted from the PBMCs according to the protocol of TRIzol &#40;Invitrogen&#44; San Diego&#44; CA&#41;&#44; followed by reverse transcription using the reverse transcription reagent kit &#40;Thermo Fisher scientific&#44; USA&#41;&#46; Then&#44; purity and concentration of total RNA were estimated by nanodrop ND1000 and at 260&#8211;280<span class="elsevierStyleHsp" style=""></span>nm purity of RNAs were assessed&#46; The entirety of total RNA was showed by gel electrophoresis of the individual samples on a 1&#37; agarose gel&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Primer design</span><p id="par0040" class="elsevierStylePara elsevierViewall">IL-6 gene sequence and data about promoter were picked up from the National Center for Biotechnology Information &#40;NCBI&#41; and eukaryotic promoter database &#40;EPD&#41;&#46; For IL-6 mRNA sequence&#44; the primer pairs were designed using OLIGO7 Software&#44; &#40;Molecular Biology Insights&#44; Inc&#46;&#44; Cascade&#44; CO&#46;&#44; USA&#41; and MethPrimer online software&#46; &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41; Also&#44; IL-6 gene Promoter CpG islands were predicted with eukaryotic promoter database &#40;EPD&#41;&#46; One pairs of IL-6 primer were designed using PrimerQuest tool to amplify CpG islands of TSS &#40;transcription start site&#41; upstream &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Real-time PCR</span><p id="par0045" class="elsevierStylePara elsevierViewall">Peripheral blood mononuclear cells &#40;PBMCs&#41; were extracted from EDTA blood tubes by Ficoll &#40;Lymphodex&#44; Inno -Train&#44; Germany&#41; density-gradient centrifugation&#46; Total RNA was extracted from the PBMCs using TRIzol &#40;Invitrogen&#44; San Diego&#44; CA&#41;&#44; followed by reverse transcription using the reverse transcription reagent kit &#40;thermofisher Scientific&#44; USA&#41; and then the expression of IL-10 was measured by MIC real-time instrument &#40;Bio Molecular Systems&#44; AUSTRALIA&#41;&#46; The following sequences of the sense and antisense primers of IL-6 were used&#58; forward 5&#8242;-GCAGAAAACAACCTGAACC-3&#8242; and reverse 5&#8242;-GCTTGTTCCTCACTACTCTC-3&#8242;&#46; &#946;-Actin was chosen as the internal reference for expression and copy number variation detection and its expression was evaluated by the following primers in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46; Relative expression levels of IL-6 were calculated using the &#916;&#916;Ct formula&#46; All tests were performed in at three biological repeats&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Methylated DNA immunoprecipitation assessment</span><p id="par0050" class="elsevierStylePara elsevierViewall">One pair of primers were designed using Primer Quest Tool and methMarker &#40;PREMIER Biosoft&#44; CA&#44; USA&#41; to amplify CpG islands of TSS &#40;transcription start site&#41; upstream &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46; Methylated DNA immunoprecipitation &#40;MeDIP&#41; was performed using EpiQuik&#8482; MeDIP Ultra Kit &#40;Epigentek&#44; Farmingdale&#44; NY&#44; USA&#41;&#46; This Kit contains all components essential for doing a successful MeDIP procedure using DNA extracted from PBMCs such as a methylated DNA &#40;mDNA&#41; control and an unmethylated DNA &#40;unDNA&#41; control and control primers that can be used with the control DNA to exhibit the enrichment efficacy and specificity for methylated DNA&#46; The extracted DNA is sonicated to produce random fragments ranging in size from 200 to 800<span class="elsevierStyleHsp" style=""></span>bp using the BANDELIN sonicator &#40;UVV&#58; 3200&#44; Germany&#41; for 15 cycles of 20<span class="elsevierStyleHsp" style=""></span>s on&#47;20<span class="elsevierStyleHsp" style=""></span>s off&#46; Fragment size was confirmed by electrophoresis on a 1&#46;5&#37; agarose gel &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#46; Then&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;g of DNA is used for following MeDIP enrichment&#46; This method was performed by 5<span class="elsevierStyleHsp" style=""></span>&#956;g of fragmented genomic DNA was diluted to 400<span class="elsevierStyleHsp" style=""></span>&#956;l in TE buffer and DNA was denatured at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min followed by immediate cooling on ice for 5<span class="elsevierStyleHsp" style=""></span>min&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0055" class="elsevierStylePara elsevierViewall">MeDIP-QPCR amplification was carried out using 1<span class="elsevierStyleHsp" style=""></span>&#956;l of eluted DNA in a 20<span class="elsevierStyleHsp" style=""></span>&#956;l PCR reaction along with primer sets&#46; The assays were performed in three replicates and relative methylation fold change was measured for each sample with FE&#37; method which is referred to below&#46; QPCR cycles and the timing steps include an activation cycle&#44; a denaturation cycle at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 2<span class="elsevierStyleHsp" style=""></span>min and 40 cycles of extension at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 10<span class="elsevierStyleHsp" style=""></span>s&#44; 54<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; and finally 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 20<span class="elsevierStyleHsp" style=""></span>s&#46;</p><p id="par0060" class="elsevierStylePara elsevierViewall">The fold enrichment &#40;FE&#41; of IL-6 fragments was calculated using a formula described in manufacture protocol of this kit using a ratio of amplification efficiency of the MeDIP sample over that of non-immune IgG&#58;<elsevierMultimedia ident="eq0005"></elsevierMultimedia></p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Statistical analysis</span><p id="par0065" class="elsevierStylePara elsevierViewall">Statistical analysis was performed using SPSS software version 17&#46;0 &#40;SPSS&#44; Chicago&#44; IL&#44; USA&#41;&#46; Normal distributions were tested with the Kolmogorov&#8211;Smirnov test with Lilliefors correction&#46; Quantitative data were presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>standard deviation &#40;SD&#41;&#46; The differences in mRNA and serum levels of IL-6 between control and BD groups were evaluated by Mann&#8211;Whitney <span class="elsevierStyleItalic">U</span> test&#46; <span class="elsevierStyleItalic">p</span>-Value &#60;0&#46;05 was considered as significant difference&#46;</p></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Results</span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Subject characteristics</span><p id="par0070" class="elsevierStylePara elsevierViewall">Patient&#39;s characteristics are shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; The patient group consisted of 29 males and 18 females&#44; with a mean age of 38&#46;02<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>10&#46;25 years&#46; The control subjects included 37 males and 24 females and had a mean age of 37&#46;4<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;5 years&#46; No significant difference was observed in age between patients with BD and controls &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Real-time quantitative PCR for IL-6 gene</span><p id="par0075" class="elsevierStylePara elsevierViewall">In order to compare the level of interleukin-6 &#40;IL-6&#41; gene expression in two groups of BD and healthy subjects&#44; an independent <span class="elsevierStyleItalic">T</span>-test was adopted&#44; taking into consideration the data obtained by employing Kolmogorov&#8211;Smirnov test&#44; was normal &#40;<span class="elsevierStyleItalic">p</span>-value &#62;0&#46;05&#41;&#46; The obtained results were indicative of significant difference between two groups &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;05&#41;&#46; As we expected&#44; the level of gene expression showed increase in BD individuals group in comparison with healthy group &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41;&#46; Also in the patient groups&#44; we analyzed the relationship between gene expression and clinical features&#46; As the results indicated&#44; the gene expression level of IL-6 was significantly different in phlebitis section that is shown as bold in table&#46; Interleukin-6 gene expression was also significantly increased in individuals with positive phlebitis &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Methylation status and mRNA expression</span><p id="par0080" class="elsevierStylePara elsevierViewall">We evaluated the association between the methylation pattern of the IL-6 gene and mRNA expression&#46; The mRNA &#40;1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;3 versus 0&#46;77<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;14&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; of IL6 was significantly higher in the patients with BD than healthy groups&#46; Also&#44; in order to compare the methylation status of interleukin-6 &#40;IL-6 in two groups of BD and healthy individuals&#44; an independent <span class="elsevierStyleItalic">T</span>-test was adopted&#44; taking into consideration the data obtained by employing Kolmogorov&#8211;Smirnov test&#44; was normal &#40;<span class="elsevierStyleItalic">p</span>-value &#62;0&#46;05&#41;&#46; The results showed that there was a statistical difference between both groups in terms of methylation rate of interleukin-6 gene &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;001&#41;&#46; In line with our expectations&#44; the methylation ratio of IL-6 revealed decrease in BD individuals group in comparison with healthy group &#40;0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08 versus 0&#46;77<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;09&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>&#41;&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia><p id="par0085" class="elsevierStylePara elsevierViewall">Also in the patient groups&#44; we analyzed the relationship between methylation level and clinical features&#46; As the results showed&#44; the methylation levels had significant differences in the arthritis section&#46; In addition&#44; the methylation level of IL-6 was lower in positive group of arthritis than the negative value &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46;</p></span></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Discussion</span><p id="par0090" class="elsevierStylePara elsevierViewall">Behcet&#39;s disease &#40;BD&#41; is an autoinflammatory disease of unknown etiology&#46; Cytokines involved can be classified as Th1&#44; Th2&#44; Th17&#44; Treg types&#44; chemokines and others proinflammatory agents&#46; The cytokine network plays an important role in the pathogenesis of diseases&#44; especially autoimmune disorders&#44; as well in the formation and progression of lesions of the organism and may be blocked by one of the basic links of cytokines&#44; which in turn may obtain the critical clues to view the target therapy program of cytokine in BD&#46;<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">30</span></a></p><p id="par0095" class="elsevierStylePara elsevierViewall">Chronic inflammation and responses creates a main mechanism for autoimmune disease&#46; The definite pathways by which the inflammation causes autoimmune are not completely recognized&#46; IL-6 is a multifunctional cytokine produced and released by inflammatory cells and can trigger intracellular transcription factors leading to gene expression&#44; cell division&#44; apoptosis processes and inflammation response&#46;<a class="elsevierStyleCrossRefs" href="#bib0325"><span class="elsevierStyleSup">25&#44;31&#44;32</span></a> Persistent differences in the production of IL-6 have been identified among different individuals in various populations with polymorphism at the end of 5&#8242; region<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">33</span></a> and the genetic associations of IL-6 polymorphism have been identified with rates of infections&#44; inflammation and immune diseases&#46; This suggested that the production rate of this cytokine is a risk factor for most diseases and their condition&#46;<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">34</span></a> However&#44; to date&#44; the role of epigenetic variable has not been reported in IL-6 gene on Beh&#231;et&#39;s disease&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">There are some findings indicated that IL-6 may stimulate immune response through the effect on the expression of effective genes by altering patterns of DNA methylation&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">35</span></a> On the other hand&#44; IL-6 production is regulated by methylation of the IL-6 gene promoter&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">35</span></a> DNA demethylation is a property of transcriptionally active genes&#44; and our results are fit with the view that the level of methylation is essential in the regulation of the IL-6 production in patients with BD and could participate in production of this cytokine as seen in BD and other autoimmune disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0375"><span class="elsevierStyleSup">35&#44;36</span></a></p><p id="par0105" class="elsevierStylePara elsevierViewall">In a study of 51 BD patients aged 16&#8211;60<span class="elsevierStyleHsp" style=""></span>y&#44; we examined the level of promoter methylation of IL-6 in association with demographic and clinical risk factors such as gender and severe BD as well as inflammation markers&#46; As the results showed&#44; the gene expression level of IL-6 was significantly different in phlebitis section&#46; IL-6 gene expression was also significantly increased in individuals with positive phlebitis&#46; Furthermore&#44; in order to compare the methylation status of IL-6 in two groups of BD and healthy individuals&#44; the results showed that there was a statistical significant difference between both groups in terms of methylation rate of IL-6 gene &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;001&#41;&#46; According to our results&#44; there was no relationship between the gene expression and its methylation in different parts of the clinical profile&#46; One of the possible reasons for these results is that our population sample size was small&#44; and if we selected a larger population size&#44; our results may be more meaningful&#46;</p><p id="par0110" class="elsevierStylePara elsevierViewall">Epigenetic differences&#44; especially the level of IL-6 methylation between BD patients and healthy group&#44; can be an initial manifestation suggested an increased risk of BD prevalence with the low methylation level of IL-6 promoter&#46; On the other hand&#44; this difference can be considered as a main manipulation for BD prevention or treatment&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">Scientists from China reported in previous studies that a significantly higher level of IL-6 in cerebrospinal fluid &#40;CSF&#41; had been detected in Chinese patients with active BD with central nervous system &#40;CNS&#41; involvement&#46;<a class="elsevierStyleCrossRef" href="#bib0385"><span class="elsevierStyleSup">37</span></a> Also&#44; in a previous study about the methylation level of the IL-6 promoter in patients with RA in comparison with healthy groups&#44; the results indicated that a single CpG site at -1&#44;181 was considerably less methylated in subjects with rheumatoid arthritis &#40;RA&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">35</span></a> Some pioneering studies demonstrated that dysregulation of immune system is related to aging&#46; Furthermore&#44; these results revealed that the level of IL-6 expression was intensified with age in animals model such as mice&#46;<a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">38</span></a> It has also been shown that the level of IL-6 are much higher in serum&#44; synovial fluid and synovial tissue in patients with severe RA compared with subjects without inflammatory arthritis which indicates that it is related to the activity of disease&#46;<a class="elsevierStyleCrossRef" href="#bib0395"><span class="elsevierStyleSup">39</span></a> Some contradictory results reported in previous studies&#46; A decrease or no effect of age on IL-6 production had been shown already&#46;<a class="elsevierStyleCrossRef" href="#bib0400"><span class="elsevierStyleSup">40</span></a> According to the results of this clinical study&#44; significant difference could not be seen between patients when dichotomized by age&#46; These diverse results may be caused by the differences in experimental conditions and the health status of subjects in various investigations&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">These results recommend that the level of methylation in promoter region of gene may be a key mechanism for regulation of IL-6 gene expression in BD and IL-6 CpG island hypomethylation might be involved in the progression of BD&#46; Besides&#44; according to the results&#44; molecular methods such as the analysis of DNA methylation could recognize in early detection by changes in the genotype and genome sequencing&#46; This may be used for early diagnosis and initiation of rapid therapies&#46; Therefore&#44; IL-6 can be used as a molecular marker for the diagnosis of Behcet&#39;s patients&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Conclusion</span><p id="par0125" class="elsevierStylePara elsevierViewall">Regarding the results of expression and methylation of IL-6 in this study&#44; it may be considered that methylation may be as one of the regulatory mechanisms involved in regulating gene expression&#46; Generally&#44; epigenetic alteration such as hypermethylation of IL-6 gene may be a potent therapeutic approach in controlling BD&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Conflict of interest</span><p id="par0130" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflicts of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:11 [
        0 => array:3 [
          "identificador" => "xres1348057"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Discussion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1240304"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1348056"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Antecedentes"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Discusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1240303"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Methods and materials"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Patients and healthy controls study group"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "DNA&#44; RNA isolation and RT-PCR method"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Primer design"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Real-time PCR"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Methylated DNA immunoprecipitation assessment"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0045"
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Subject characteristics"
            ]
            1 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Real-time quantitative PCR for IL-6 gene"
            ]
            2 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Methylation status and mRNA expression"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0065"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Conclusion"
        ]
        9 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Conflict of interest"
        ]
        10 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2017-12-11"
    "fechaAceptado" => "2018-06-22"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1240304"
          "palabras" => array:4 [
            0 => "Beh&#231;et&#39;s disease"
            1 => "IL-6"
            2 => "MeDIP-qPCR"
            3 => "Methylation"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1240303"
          "palabras" => array:4 [
            0 => "S&#237;ndrome de Beh&#231;et"
            1 => "IL-6"
            2 => "MeDIP-qPCR"
            3 => "Metilaci&#243;n"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">IL-6 mRNA expression is significantly high in many autoimmune diseases such as Beh&#231;et&#39;s disease&#59; this is often related with more aggressive phenotypes&#46; Nevertheless&#44; the essential molecular process for its high expression has not been completely realized&#46; The aim of this study was undertaken to estimate the gene copy number variation and promoter methylation to IL-6&#39;s high expression&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">This study was performed on 51 patients and 61 healthy controls&#46; Initially&#44; DNA and RNA were extracted from all specimens&#46; Promoter methylation levels of IL-6 were evaluated by MeDIP-qPCR technique&#46; Also&#44; IL-6 gene expression was measured by Real-time PCR&#46; After that&#44; we evaluated the relationship between gene expression and methylation&#44; as well as their relationship with clinical specification&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">As we expected&#44; the expression level of IL-6 gene increased significantly in the patient group compared to the healthy subjects&#46; Also&#44; the relative promoter methylation level of the IL-6 mRNA was significantly lower in patient group compared to healthy group &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Discussion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">We disclosed that the promoter hypomethylation may be considered as one of the main defects for IL-6 mRNA high expression in patients with Beh&#231;et&#39;s disease&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Discussion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Antecedentes</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">La expresi&#243;n de ARNm de IL-6 es significativamente elevada en muchas enfermedades autoinmunes&#44; tales como el s&#237;ndrome de Beh&#231;et&#44; y ello se relaciona a menudo con fenotipos m&#225;s agresivos&#46; Sin embargo&#44; no se ha comprendido plenamente el proceso molecular esencial para esta expresi&#243;n elevada&#46; El objetivo de este estudio fue la estimaci&#243;n de la variaci&#243;n del n&#250;mero de copias del gen&#44; y la metilaci&#243;n del promotor de la expresi&#243;n elevada de IL-6&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">M&#233;todos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Este estudio se realiz&#243; en 51 pacientes y 61 controles sanos&#46; Al inicio&#44; se extrajo ADN y ARN de todas las muestras&#46; Se evaluaron los niveles de metilaci&#243;n del promotor de IL-6 mediante la t&#233;cnica MeDIP-qPCR&#46; Tambi&#233;n se midi&#243; la expresi&#243;n del gen IL-6 mediante PCR a tiempo real&#46; Tras ello&#44; evaluamos la relaci&#243;n entre la expresi&#243;n del gen y la metilaci&#243;n&#44; as&#237; como su relaci&#243;n con la especificaci&#243;n cl&#237;nica&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Seg&#250;n lo previsto&#44; el nivel de expresi&#243;n del gen IL-6 se increment&#243; significativamente en el grupo de pacientes&#44; con respecto a los sujetos sanos&#46; Tambi&#233;n encontramos que el nivel relativo de metilaci&#243;n del promotor de ARNm de IL-6 fue considerablemente menor en el grupo de pacientes&#44; con respecto al grupo sano &#40;p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;001&#41;&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Discusi&#243;n</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Concluimos que la hipometilaci&#243;n del promotor puede considerarse uno de los defectos principales de la expresi&#243;n elevada de ARNm de IL-6&#44; en los pacientes con s&#237;ndrome de Beh&#231;et&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Antecedentes"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Discusi&#243;n"
          ]
        ]
      ]
    ]
    "multimedia" => array:7 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 781
            "Ancho" => 2500
            "Tamanyo" => 135146
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">IL-6 promoter methylation&#46; CpG site and island around transcription start site &#40;TSS&#41; were predicted by EPD&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 960
            "Ancho" => 1500
            "Tamanyo" => 48184
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">DNA shearing in gel electrophoresis&#46; Lane &#40;1&#41; 100<span class="elsevierStyleHsp" style=""></span>bp ladder&#44; the extracted DNA is sonicated&#44; load in lanes &#40;3&#8211;8&#41; and Lane &#40;2&#41;&#58; missed&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1072
            "Ancho" => 1529
            "Tamanyo" => 43154
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Change fold of IL-6 expression&#46; Regarding the average changes in the expression of the IL-6 gene in the patients and the healthy groups&#44; the amount of it is comparable to that of the healthy group in the patient group&#44; which indicates that IL-6 gene expression was increased among the patients in the patient group&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1083
            "Ancho" => 1530
            "Tamanyo" => 45647
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Change fold of IL-6 methylation&#46; As shown in the chart&#44; the level of interleukin-6 methylation in the patient group is significantly lower than the healthy group&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence of primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Product size&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Tm&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">IL-6 for gene expression&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCAGAAAACAACCTGAACCGCTTGTTCCTCACTACTCTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">164&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">55&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#946;-Actin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGTGAAGGTGACAGCAGTTGGGGTGGCTTTTAGGAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">154&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">55&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">IL-6 for MeDIP&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCAGGAGAAGATTCCAAAGATGTACGTCGAGGATGTACCGAATTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">94&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">54&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2313768.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">PCR primers and product size&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">As shown in the table&#44; items that have a statistically significant difference are shown as bold&#46; IL-6&#58; interleukin-6&#44; SD&#58; standard deviation&#44; HLA&#58; Human leukocyte antigen&#44; BD&#58; Beh&#231;et&#39;s disease&#44; EN&#58; Erythema Nodosum&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Characteristics and clinical features expression&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Frequency&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Change fold of IL-6 expression&#40;mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Methylation level of IL-6 expression&#40;mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Age</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>&#60;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31 &#40;63&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;13</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;09&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;76</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>&#8805;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;28&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;1<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;71<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Gender</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;29&#41; 61&#46;7&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;2<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;41</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;75<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;18</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;18&#41; 38&#46;3&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;05<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;72<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">HLA-B5-</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17 &#40;33&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;93<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;36</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;31</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;21&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;35<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;86&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;65<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;09&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">HLA-B51</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;15&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;8<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;9</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;5</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;13&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;65<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">HLA-B27</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;34<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;46&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;17</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;88</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">23 &#40;44&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;88<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Oral aphtha</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">45 &#40;96&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;6<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;35</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;5</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;6<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;87&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;74<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;04&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Genital ulcer</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24 &#40;51&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;78</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;18</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">23 &#40;49&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;66<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;71<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Arthritis</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;19&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;97</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle"><span class="elsevierStyleBold">0&#46;04</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">38 &#40;81&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;74<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Sever B&#46;D&#46;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30 &#40;64&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;41</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;41</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17 &#40;36&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;91<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;71<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Severe eye involvement</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;22&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;9</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;64</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">36 &#40;78&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">EN</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;16&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;62</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;94</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">38 &#40;84&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;8<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Phlebitis</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;11&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;97&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle"><span class="elsevierStyleBold">0&#46;04</span></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;74<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;29</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">41 &#40;89&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;6<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Ocular</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>No eye involvement&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11 &#40;23&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="3" align="char" valign="middle">0&#46;44</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;75<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="3" align="char" valign="middle">0&#46;26</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>One eye activity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;33&#37;&#41;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;1<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;67<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Bilateral activity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21 &#40;44&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;4<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Cataract</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;19&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;1<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;28</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;84</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">36 &#40;74&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;6<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Vision loss</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>One eye&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;13&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;84</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;67<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;45</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>No eye&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">38 &#40;77&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;78<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;34&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2313767.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Clinical profile of patients with IL-6 gene expression and its methylation&#46;</p>"
        ]
      ]
      6 => array:5 [
        "identificador" => "eq0005"
        "tipo" => "MULTIMEDIAFORMULA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Formula" => array:5 [
          "Matematica" => "FE&#37;&#61;2&#40;IgG CT&#8722;Sample CT&#41;&#215;100&#37;"
          "Fichero" => "STRIPIN_si1.jpeg"
          "Tamanyo" => 1600
          "Alto" => 14
          "Ancho" => 203
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:40 [
            0 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "S&#46; Hirohata"
                            1 => "H&#46; Kikuchi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Arthritis Res Ther"
                        "fecha" => "2003"
                        "volumen" => "5"
                        "paginaInicial" => "139"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epidemiology of Beh&#231;et&#39;s syndrome and regional differences in disease expression&#46; Beh&#231;et&#39;s syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "S&#46; Yurdakul"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:4 [
                        "fecha" => "2010"
                        "paginaInicial" => "35"
                        "paginaFinal" => "52"
                        "editorial" => "Springer"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of a susceptibility locus in STAT4 for Beh&#231;et&#39;s disease in Han Chinese in a genome-wide association study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Hou"
                            1 => "Z&#46; Yang"
                            2 => "L&#46; Du"
                            3 => "Z&#46; Jiang"
                            4 => "Q&#46; Shu"
                            5 => "Y&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Arthritis Rheumatol"
                        "fecha" => "2012"
                        "volumen" => "64"
                        "paginaInicial" => "4104"
                        "paginaFinal" => "4113"
                        "itemHostRev" => array:3 [
                          "pii" => "S0378512216304029"
                          "estado" => "S300"
                          "issn" => "03785122"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Vitamin D receptor gene polymorphisms in Iranian Azary patients with Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Kolahi"
                            1 => "A&#46; Khabbazi"
                            2 => "H&#46; Khodadadi"
                            3 => "M&#46; Estiar"
                            4 => "M&#46; Hajialiloo"
                            5 => "L&#46; Emrahi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/03009742.2014.945477"
                      "Revista" => array:6 [
                        "tituloSerie" => "Scand J Rheumatol"
                        "fecha" => "2015"
                        "volumen" => "44"
                        "paginaInicial" => "163"
                        "paginaFinal" => "167"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25421258"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Upregulated IL-23 and IL-17 in Beh&#231;et patients with active uveitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46; Chi"
                            1 => "X&#46; Zhu"
                            2 => "P&#46; Yang"
                            3 => "X&#46; Liu"
                            4 => "X&#46; Lin"
                            5 => "H&#46; Zhou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Investig Ophthalmol Vis Sci"
                        "fecha" => "2008"
                        "volumen" => "49"
                        "paginaInicial" => "3058"
                        "paginaFinal" => "3064"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genome-wide association studies identify IL23R-IL12RB2 and IL10 as Beh&#231;et&#39;s disease susceptibility loci"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46; Mizuki"
                            1 => "A&#46; Meguro"
                            2 => "M&#46; Ota"
                            3 => "S&#46; Ohno"
                            4 => "T&#46; Shiota"
                            5 => "T&#46; Kawagoe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Nat Genet"
                        "fecha" => "2010"
                        "volumen" => "42"
                        "paginaInicial" => "703"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A single nucleotide polymorphism in the FOXP3 gene associated with Behcet&#39;s disease in an Iranian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Hosseini"
                            1 => "D&#46; Shanehbandi"
                            2 => "M&#46;A&#46; Estiar"
                            3 => "S&#46; Gholizadeh"
                            4 => "A&#46; Khabbazi"
                            5 => "H&#46; Khodadadi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.7754/clin.lab.2015.150433"
                      "Revista" => array:7 [
                        "tituloSerie" => "Clin Lab"
                        "fecha" => "2015"
                        "volumen" => "61"
                        "paginaInicial" => "1897"
                        "paginaFinal" => "1903"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26882813"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0025619617308339"
                          "estado" => "S300"
                          "issn" => "00256196"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of interleukin-2&#44; interleukin-4 and transforming growth factor-beta gene polymorphisms with Behcet&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Shahram"
                            1 => "E&#46; Nikoopour"
                            2 => "N&#46; Rezaei"
                            3 => "K&#46; Saeedfar"
                            4 => "N&#46; Ziaei"
                            5 => "F&#46; Davatchi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Clin Exp Rheumatol"
                        "fecha" => "2011"
                        "volumen" => "29"
                        "numero" => "Suppl&#46; 67"
                        "paginaInicial" => "S28"
                        "paginaFinal" => "S31"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21640045"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Decreased interleukin 27 expression is associated with active uveitis in Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "C&#46; Wang"
                            1 => "Y&#46; Tian"
                            2 => "Z&#46; Ye"
                            3 => "A&#46; Kijlstra"
                            4 => "Y&#46; Zhou"
                            5 => "P&#46; Yang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/ar4570"
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Res Ther"
                        "fecha" => "2014"
                        "volumen" => "16"
                        "paginaInicial" => "R117"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24887071"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serum levels of TNF-&#945;&#44; sIL-2R&#44; IL-6&#44; and IL-8 are increased and associated with elevated lipid peroxidation in patients with Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "C&#46; Evereklioglu"
                            1 => "H&#46; Er"
                            2 => "Y&#46; T&#252;rk&#246;z"
                            3 => "M&#46; &#199;ekmen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Mediat Inflamm"
                        "fecha" => "2002"
                        "volumen" => "11"
                        "paginaInicial" => "87"
                        "paginaFinal" => "93"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Principles of interleukin &#40;IL&#41;-6-type cytokine signalling and its regulation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "P&#46;C&#46; Heinrich"
                            1 => "I&#46; Behrmann"
                            2 => "H&#46; Serge"
                            3 => "H&#46;M&#46; Hermanns"
                            4 => "G&#46; M&#252;ller-Newen"
                            5 => "F&#46; Schaper"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1042/BJ20030407"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochem J"
                        "fecha" => "2003"
                        "volumen" => "374"
                        "paginaInicial" => "1"
                        "paginaFinal" => "20"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12773095"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0167527315300796"
                          "estado" => "S300"
                          "issn" => "01675273"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cytokines in Behcet&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "N&#46; Sayinalp"
                            1 => "O&#46; Ozcebe"
                            2 => "O&#46; Ozdemir"
                            3 => "I&#46; Haznedaro&#287;lu"
                            4 => "S&#46; D&#252;ndar"
                            5 => "S&#46; Kirazli"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Rheumatol"
                        "fecha" => "1996"
                        "volumen" => "23"
                        "paginaInicial" => "321"
                        "paginaFinal" => "322"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8882039"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin-6-type cytokine signalling through the gp130&#47;Jak&#47;STAT pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "P&#46;C&#46; Heinrich"
                            1 => "I&#46; Behrmann"
                            2 => "G&#46; M&#252;ller-Newen"
                            3 => "F&#46; Schaper"
                            4 => "L&#46; Graeve"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Biochem J"
                        "fecha" => "1998"
                        "volumen" => "334"
                        "paginaInicial" => "297"
                        "paginaFinal" => "314"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epigenetic modifications of interleukin-6 in synovial fibroblasts from osteoarthritis patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Yang"
                            1 => "S&#46; Zhou"
                            2 => "C&#46; Wang"
                            3 => "Y&#46; Huang"
                            4 => "H&#46; Li"
                            5 => "Y&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/srep43592"
                      "Revista" => array:5 [
                        "tituloSerie" => "Sci Rep"
                        "fecha" => "2017"
                        "volumen" => "7"
                        "paginaInicial" => "43592"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28262826"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "KLF4 modulates expression of IL-6 in dendritic cells via both promoter activation and epigenetic modification"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46;M&#46; Rosenzweig"
                            1 => "J&#46;D&#46; Glenn"
                            2 => "P&#46;A&#46; Calabresi"
                            3 => "K&#46;A&#46; Whartenby"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2013"
                        "volumen" => "288"
                        "paginaInicial" => "23868"
                        "paginaFinal" => "23874"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epigenetic alterations in chronic disease focusing on Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Alipour"
                            1 => "M&#46; Nouri"
                            2 => "E&#46; Sakhinia"
                            3 => "N&#46; Samadi"
                            4 => "N&#46; Roshanravan"
                            5 => "A&#46; Ghavami"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.biopha.2017.04.106"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biomed Pharmacother"
                        "fecha" => "2017"
                        "volumen" => "91"
                        "paginaInicial" => "526"
                        "paginaFinal" => "533"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28482290"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A gene hypermethylation profile of human cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Esteller"
                            1 => "P&#46;G&#46; Corn"
                            2 => "S&#46;B&#46; Baylin"
                            3 => "J&#46;G&#46; Herman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Res"
                        "fecha" => "2001"
                        "volumen" => "61"
                        "paginaInicial" => "3225"
                        "paginaFinal" => "3229"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11309270"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mechanisms of disease&#58; the developmental origins of disease and the role of the epigenotype"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "S&#46;E&#46; Ozanne"
                            1 => "M&#46; Const&#226;ncia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Rev Endocrinol"
                        "fecha" => "2007"
                        "volumen" => "3"
                        "paginaInicial" => "539"
                        "itemHostRev" => array:3 [
                          "pii" => "S0140673614617748"
                          "estado" => "S300"
                          "issn" => "01406736"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Methylation and demethylation in the regulation of genes&#44; cells&#44; and responses in the immune system"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46;R&#46; Fitzpatrick"
                            1 => "C&#46;B&#46; Wilson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s1521-6616(03)00205-5"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Immunol"
                        "fecha" => "2003"
                        "volumen" => "109"
                        "paginaInicial" => "37"
                        "paginaFinal" => "45"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14585274"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of a coordinate regulator of interleukins 4&#44; 13&#44; and 5 by cross-species sequence comparisons"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46;G&#46; Loots"
                            1 => "R&#46;M&#46; Locksley"
                            2 => "C&#46;M&#46; Blankespoor"
                            3 => "Z&#46;-E&#46; Wang"
                            4 => "W&#46; Miller"
                            5 => "E&#46;M&#46; Rubin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1126/science.288.5463.136"
                      "Revista" => array:6 [
                        "tituloSerie" => "Science"
                        "fecha" => "2000"
                        "volumen" => "288"
                        "paginaInicial" => "136"
                        "paginaFinal" => "140"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10753117"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "IL-6&#58; a regulator of the transition from neutrophil to monocyte recruitment during inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "G&#46; Kaplanski"
                            1 => "V&#46; Marin"
                            2 => "F&#46; Montero-Julian"
                            3 => "A&#46; Mantovani"
                            4 => "C&#46; Farnarier"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s1471-4906(02)00013-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "Trends Immunol"
                        "fecha" => "2003"
                        "volumen" => "24"
                        "paginaInicial" => "25"
                        "paginaFinal" => "29"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12495721"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin-1&#946; induces synthesis and secretion of interleukin-6 in human chondrocytes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Bender"
                            1 => "H&#46;-D&#46; Haubeck"
                            2 => "E&#46; Van de Leur"
                            3 => "G&#46; Dufhues"
                            4 => "X&#46; Schiel"
                            5 => "J&#46; Lauwerijns"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "FEBS Lett"
                        "fecha" => "1990"
                        "volumen" => "263"
                        "paginaInicial" => "321"
                        "paginaFinal" => "324"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases&#44; matrix metalloproteinases&#44; and other destructive and inflammatory responses in osteoarthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46; Bondeson"
                            1 => "S&#46;D&#46; Wainwright"
                            2 => "S&#46; Lauder"
                            3 => "N&#46; Amos"
                            4 => "C&#46;E&#46; Hughes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/ar2099"
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Res Ther"
                        "fecha" => "2006"
                        "volumen" => "8"
                        "paginaInicial" => "R187"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17177994"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interactions between IL17A&#44; IL23R&#44; and STAT4 polymorphisms confer susceptibility to intestinal Behcet&#39;s disease in Korean population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;S&#46; Kim"
                            1 => "S&#46;W&#46; Kim"
                            2 => "C&#46;M&#46; Moon"
                            3 => "J&#46;J&#46; Park"
                            4 => "T&#46;I&#46; Kim"
                            5 => "W&#46;H&#46; Kim"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.lfs.2012.03.017"
                      "Revista" => array:7 [
                        "tituloSerie" => "Life Sci"
                        "fecha" => "2012"
                        "volumen" => "90"
                        "paginaInicial" => "740"
                        "paginaFinal" => "746"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22483685"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0002914916305616"
                          "estado" => "S300"
                          "issn" => "00029149"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "IL-6 in autoimmune disease and chronic inflammatory proliferative disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "K&#46; Ishihara"
                            1 => "T&#46; Hirano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s1359-6101(02)00027-8"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cytokine Growth Factor Rev"
                        "fecha" => "2002"
                        "volumen" => "13"
                        "paginaInicial" => "357"
                        "paginaFinal" => "368"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12220549"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "IL-6 is an antiinflammatory cytokine required for controlling local or systemic acute inflammatory responses"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Z&#46; Xing"
                            1 => "J&#46; Gauldie"
                            2 => "G&#46; Cox"
                            3 => "H&#46; Baumann"
                            4 => "M&#46; Jordana"
                            5 => "X&#46;-F&#46; Lei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI1368"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Investig"
                        "fecha" => "1998"
                        "volumen" => "101"
                        "paginaInicial" => "311"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9435302"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin 1 receptor antagonist &#40;IL-1Ra&#41; is an acute-phase protein"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "C&#46; Gabay"
                            1 => "M&#46;F&#46; Smith"
                            2 => "D&#46; Eidlen"
                            3 => "W&#46;P&#46; Arend"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI119488"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Investig"
                        "fecha" => "1997"
                        "volumen" => "99"
                        "paginaInicial" => "2930"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9185517"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Validation of the International Study Group criteria for Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46; O&#8217;Neill"
                            1 => "A&#46; Rigby"
                            2 => "A&#46; Silman"
                            3 => "C&#46; Barnes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rheumatology"
                        "fecha" => "1994"
                        "volumen" => "33"
                        "paginaInicial" => "115"
                        "paginaFinal" => "117"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Rapid genomic DNA extraction &#40;RGDE&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S&#46;M&#46; Ali"
                            1 => "S&#46; Mahnaz"
                            2 => "T&#46; Mahmood"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Forensic Sci Int&#58; Genet Suppl Ser"
                        "fecha" => "2008"
                        "volumen" => "1"
                        "paginaInicial" => "63"
                        "paginaFinal" => "65"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cytokines and Behcet&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Z&#46; Zhou"
                            1 => "S&#46; Chen"
                            2 => "N&#46; Shen"
                            3 => "Y&#46; Lu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.autrev.2011.12.005"
                      "Revista" => array:6 [
                        "tituloSerie" => "Autoimmun Rev"
                        "fecha" => "2012"
                        "volumen" => "11"
                        "paginaInicial" => "699"
                        "paginaFinal" => "704"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22197901"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interplay between IFN-&#947; and IL-6 signaling governs neutrophil trafficking and apoptosis during acute inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46;M&#46; McLoughlin"
                            1 => "J&#46; Witowski"
                            2 => "R&#46;L&#46; Robson"
                            3 => "T&#46;S&#46; Wilkinson"
                            4 => "S&#46;M&#46; Hurst"
                            5 => "A&#46;S&#46; Williams"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI17129"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Investig"
                        "fecha" => "2003"
                        "volumen" => "112"
                        "paginaInicial" => "598"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12925700"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1525861013003034"
                          "estado" => "S300"
                          "issn" => "15258610"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Roles of STAT3 in mediating the cell growth&#44; differentiation and survival signals relayed through the IL-6 family of cytokine receptors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "T&#46; Hirano"
                            1 => "K&#46; Ishihara"
                            2 => "M&#46; Hibi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.onc.1203551"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncogene"
                        "fecha" => "2000"
                        "volumen" => "19"
                        "paginaInicial" => "2548"
                        "paginaFinal" => "2556"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10851053"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The effect of novel polymorphisms in the interleukin-6 &#40;IL-6&#41; gene on IL-6 transcription and plasma IL-6 levels&#44; and an association with systemic-onset juvenile chronic arthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Fishman"
                            1 => "G&#46; Faulds"
                            2 => "R&#46; Jeffery"
                            3 => "V&#46; Mohamed-Ali"
                            4 => "J&#46;S&#46; Yudkin"
                            5 => "S&#46; Humphries"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI2629"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Investig"
                        "fecha" => "1998"
                        "volumen" => "102"
                        "paginaInicial" => "1369"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9769329"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Novel IL-6 haplotypes and disease association"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Fife"
                            1 => "E&#46; Ogilvie"
                            2 => "D&#46; Kelberman"
                            3 => "J&#46; Samuel"
                            4 => "A&#46; Gutierrez"
                            5 => "S&#46; Humphries"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.gene.6364186"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genes Immunity"
                        "fecha" => "2005"
                        "volumen" => "6"
                        "paginaInicial" => "367"
                        "paginaFinal" => "370"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15815691"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Methylation status of a single CpG site in the IL6 promoter is related to IL6 messenger RNA levels and rheumatoid arthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "C&#46;J&#46; Nile"
                            1 => "R&#46;C&#46; Read"
                            2 => "M&#46; Akil"
                            3 => "G&#46;W&#46; Duff"
                            4 => "A&#46;G&#46; Wilson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Rheumatol"
                        "fecha" => "2008"
                        "volumen" => "58"
                        "paginaInicial" => "2686"
                        "paginaFinal" => "2693"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin-6 &#40;IL-6&#41; in patients with Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Yamakawa"
                            1 => "Y&#46; Sugita"
                            2 => "T&#46; Nagatani"
                            3 => "S&#46; Takahashi"
                            4 => "T&#46; Yamakawa"
                            5 => "S&#46;-i&#46; Tanaka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/0923-1811(95)00439-4"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Dermatol Sci"
                        "fecha" => "1996"
                        "volumen" => "11"
                        "paginaInicial" => "189"
                        "paginaFinal" => "195"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8785169"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Anticardiolipin antibodies and interleukin-6 in cerebrospinal fluid and blood of Chinese patients with neuro-Beh&#231;et&#39;s syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "C&#46; Wang"
                            1 => "C&#46; Chuang"
                            2 => "C&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Exp Rheumatol"
                        "fecha" => "1991"
                        "volumen" => "10"
                        "paginaInicial" => "599"
                        "paginaFinal" => "602"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1483312"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Age-associated increase in interleukin 6 in MRL&#47;lpr mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Tang"
                            1 => "T&#46; Matsuda"
                            2 => "S&#46; Akira"
                            3 => "N&#46; Nagata"
                            4 => "S&#46; Ikehara"
                            5 => "T&#46; Hirano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/intimm/3.3.273"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int Immunol"
                        "fecha" => "1991"
                        "volumen" => "3"
                        "paginaInicial" => "273"
                        "paginaFinal" => "278"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2049341"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0395"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "In situ hybridization of IL-6 in rheumatoid arthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "N&#46; Wood"
                            1 => "J&#46; Symons"
                            2 => "E&#46; Dickens"
                            3 => "G&#46; Duff"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2249.1992.tb02972.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Exp Immunol"
                        "fecha" => "1992"
                        "volumen" => "87"
                        "paginaInicial" => "183"
                        "paginaFinal" => "189"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1531188"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0400"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin-6 production does not increase with age"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46;A&#46; Beharka"
                            1 => "M&#46; Meydani"
                            2 => "D&#46; Wu"
                            3 => "L&#46;S&#46; Leka"
                            4 => "A&#46; Meydani"
                            5 => "S&#46;N&#46; Meydani"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Gerontol Ser A&#58; Biol Sci Med Sci"
                        "fecha" => "2001"
                        "volumen" => "56"
                        "paginaInicial" => "B81"
                        "paginaFinal" => "B88"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/1699258X/0000001600000003/v1_202006131050/S1699258X18301244/v1_202006131050/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "17499"
    "tipo" => "SECCION"
    "es" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "es"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/1699258X/0000001600000003/v1_202006131050/S1699258X18301244/v1_202006131050/en/main.pdf?idApp=UINPBA00004M&text.app=https://reumatologiaclinica.org/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X18301244?idApp=UINPBA00004M"
]
Compartir