Methylation status of interleukin-6 gene promoter in patients with Behçet's disease

array:22 ["pii" => "S1699258X18301244" "issn" => "1699258X" "doi" => "10.1016/j.reuma.2018.06.006" "estado" => "S300" "fechaPublicacion" => "2020-05-01" "aid" => "1241" "copyrightAnyo" => "2018" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Reumatol Clin. 2020;16:229-34" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 238 "formatos" => array:3 [ "EPUB" => 29 "HTML" => 89 "PDF" => 120 ] ] "itemSiguiente" => array:18 [ "pii" => "S1699258X18301220" "issn" => "1699258X" "doi" => "10.1016/j.reuma.2018.06.004" "estado" => "S300" "fechaPublicacion" => "2020-05-01" "aid" => "1239" "copyright" => "Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología" "documento" => "simple-article" "crossmark" => 1 "subdocumento" => "crp" "cita" => "Reumatol Clin. 2020;16:235-8" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 326 "formatos" => array:3 [ "EPUB" => 40 "HTML" => 166 "PDF" => 120 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Brief Report" "titulo" => "Elderly-onset sarcoidosis: A single center comparative study" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "235" "paginaFinal" => "238" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Estudio comparativo entre la sarcoidosis de inicio en la edad adulta y en la tercera edad. Análisis de 131 casos" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Senol Kobak, Fidan Yildiz, Huseyin Semiz, Mehmet Orman" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Senol" "apellidos" => "Kobak" ] 1 => array:2 [ "nombre" => "Fidan" "apellidos" => "Yildiz" ] 2 => array:2 [ "nombre" => "Huseyin" "apellidos" => "Semiz" ] 3 => array:2 [ "nombre" => "Mehmet" "apellidos" => "Orman" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X18301220?idApp=UINPBA00004M" "url" => "/1699258X/0000001600000003/v1_202006131050/S1699258X18301220/v1_202006131050/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1699258X18301256" "issn" => "1699258X" "doi" => "10.1016/j.reuma.2018.06.007" "estado" => "S300" "fechaPublicacion" => "2020-05-01" "aid" => "1242" "copyright" => "Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Reumatol Clin. 2020;16:222-8" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 690 "formatos" => array:3 [ "EPUB" => 38 "HTML" => 466 "PDF" => 186 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Eficacia y seguridad de los glucocorticoides en la artritis reumatoide: revisión sistemática de la literatura" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "222" "paginaFinal" => "228" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Efficacy and safety of glucocorticoids in rheumatoid arthritis: Systematic literature review" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1001 "Ancho" => 1544 "Tamanyo" => 100506 ] ] "descripcion" => array:1 [ "es" => "Diagrama de flujo de los estudios." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Raimon Sanmartí, Jesús Tornero, Javier Narváez, Alejandro Muñoz, Elena Garmendia, Ana M. Ortiz, Miguel Angel Abad, Patricia Moya, María Lourdes Mateo, Delia Reina, Juan Salvatierra-Ossorio, Sergio Rodriguez, Natalia Palmou-Fontana, Ana Ruibal-Escribano, Jaime Calvo-Alén" "autores" => array:15 [ 0 => array:2 [ "nombre" => "Raimon" "apellidos" => "Sanmartí" ] 1 => array:2 [ "nombre" => "Jesús" "apellidos" => "Tornero" ] 2 => array:2 [ "nombre" => "Javier" "apellidos" => "Narváez" ] 3 => array:2 [ "nombre" => "Alejandro" "apellidos" => "Muñoz" ] 4 => array:2 [ "nombre" => "Elena" "apellidos" => "Garmendia" ] 5 => array:2 [ "nombre" => "Ana M." "apellidos" => "Ortiz" ] 6 => array:2 [ "nombre" => "Miguel Angel" "apellidos" => "Abad" ] 7 => array:2 [ "nombre" => "Patricia" "apellidos" => "Moya" ] 8 => array:2 [ "nombre" => "María Lourdes" "apellidos" => "Mateo" ] 9 => array:2 [ "nombre" => "Delia" "apellidos" => "Reina" ] 10 => array:2 [ "nombre" => "Juan" "apellidos" => "Salvatierra-Ossorio" ] 11 => array:2 [ "nombre" => "Sergio" "apellidos" => "Rodriguez" ] 12 => array:2 [ "nombre" => "Natalia" "apellidos" => "Palmou-Fontana" ] 13 => array:2 [ "nombre" => "Ana" "apellidos" => "Ruibal-Escribano" ] 14 => array:2 [ "nombre" => "Jaime" "apellidos" => "Calvo-Alén" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2173574319301169" "doi" => "10.1016/j.reumae.2018.06.004" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574319301169?idApp=UINPBA00004M" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X18301256?idApp=UINPBA00004M" "url" => "/1699258X/0000001600000003/v1_202006131050/S1699258X18301256/v1_202006131050/es/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original Article" "titulo" => "Methylation status of interleukin-6 gene promoter in patients with Behçet's disease" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "229" "paginaFinal" => "234" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Shahriar Alipour, Ebrahim Sakhinia, Alireza Khabbazi, Nasser Samadi, Zohreh Babaloo, Mahdi Azad, Somayeh Abolhasani, Jafar Farhadi, Golamreza Jadideslam, Neda Roshanravan, Mohammad Nouri" "autores" => array:11 [ 0 => array:3 [ "nombre" => "Shahriar" "apellidos" => "Alipour" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 1 => array:3 [ "nombre" => "Ebrahim" "apellidos" => "Sakhinia" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 2 => array:3 [ "nombre" => "Alireza" "apellidos" => "Khabbazi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "Nasser" "apellidos" => "Samadi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] ] ] 4 => array:3 [ "nombre" => "Zohreh" "apellidos" => "Babaloo" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "e" "identificador" => "aff0025" ] ] ] 5 => array:3 [ "nombre" => "Mahdi" "apellidos" => "Azad" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "f" "identificador" => "aff0030" ] ] ] 6 => array:3 [ "nombre" => "Somayeh" "apellidos" => "Abolhasani" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "g" "identificador" => "aff0035" ] ] ] 7 => array:3 [ "nombre" => "Jafar" "apellidos" => "Farhadi" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 8 => array:3 [ "nombre" => "Golamreza" "apellidos" => "Jadideslam" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 9 => array:3 [ "nombre" => "Neda" "apellidos" => "Roshanravan" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "h" "identificador" => "aff0040" ] ] ] 10 => array:4 [ "nombre" => "Mohammad" "apellidos" => "Nouri" "email" => array:1 [ 0 => "nourimd@yahoo.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:8 [ 0 => array:3 [ "entidad" => "Molecular Medicine, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Iran" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Connective Tissue Diseases Research Center, Tabriz University of Medical Science, Iran" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Department of Biochemistry, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Cancer Biochemistry, Cancer Biotechnology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Department of Immunology Medicine Faculty, Tabriz University of Medical Sciences, Tabriz, Iran" "etiqueta" => "e" "identificador" => "aff0025" ] 5 => array:3 [ "entidad" => "Department of Medical Laboratory Sciences, Faculty of Allied Medicine, Qazvin University of Medical Sciences, Qazvin, Iran" "etiqueta" => "f" "identificador" => "aff0030" ] 6 => array:3 [ "entidad" => "Faculty of Dentistry, Tabriz University of Medical Sciences, Tabriz, Iran" "etiqueta" => "g" "identificador" => "aff0035" ] 7 => array:3 [ "entidad" => "Cardiovascular Research Center, Tabriz University of Medical Sciences, Tabriz, Iran" "etiqueta" => "h" "identificador" => "aff0040" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Estatus de la metilación del promotor del gen interleucina-6 en pacientes con síndrome de Behçet" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0020" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1083 "Ancho" => 1530 "Tamanyo" => 45647 ] ] "descripcion" => array:1 [ "en" => "Change fold of IL-6 methylation. As shown in the chart, the level of interleukin-6 methylation in the patient group is significantly lower than the healthy group." ] ] ] "textoCompleto" => "IntroductionBehcet's is an autoinflammatory disease that is defined by Hulusi Behcet in 1937 as an inflammatory process of unknown etiology, characterized by recurrent aphthous stomatitis, uveitis, genital ulcers, and skin lesions.<a class="elsevierStyleCrossRef" href="#bib0205">1</a> Although Behçet's disease (BD) is an extensive and worldwide disease in different parts of the world, it has remarkable local differences, with the maximum of incidences in the Mediterranean, the Middle East, and the Far East which was locally called the Silk Road. Most prevalence of Behçet's disease has been reported in Turkey including 421 people per 105.<a class="elsevierStyleCrossRef" href="#bib0210">2</a> Among all genetic factors, HLA-B51 has been confirmed as the strongest risk factor for BD, which was verified in various populations. More recently studies have disclosed the association of many non-HLA genes with the BD, such as chemokine receptor 1 (CCR1),<a class="elsevierStyleCrossRef" href="#bib0215">3</a> Vitamin D Receptor (VDR),<a class="elsevierStyleCrossRef" href="#bib0220">4</a> interleukin-23 (IL-23),<a class="elsevierStyleCrossRef" href="#bib0225">5</a> IL-23R and IL-12RB2,<a class="elsevierStyleCrossRefs" href="#bib0215">3,6</a> fork head box P3 (Foxp3),<a class="elsevierStyleCrossRef" href="#bib0235">7</a> IL-2, IL-4, transforming growth factor (TGF)-beta,<a class="elsevierStyleCrossRef" href="#bib0240">8</a> IL-27<a class="elsevierStyleCrossRef" href="#bib0245">9</a> and IL-6<a class="elsevierStyleCrossRef" href="#bib0250">10</a> for BD.IL-6 is a multifunctional cytokine with a wide-range of biologic activities such as the regulation of the acute-phase response to infection.<a class="elsevierStyleCrossRef" href="#bib0255">11</a> Dysregulation and dysfunction of IL-6 gene expression contributes to the inception of numerous diseases, such as several types of cancer, autoimmune disease for example rheumatoid arthritis (RA), type 1 diabetes (T1D), inflammatory bowel disease (IBD), multiple sclerosis (MS), and autoinflammatory disorders such as Behçet's disease (BD).<a class="elsevierStyleCrossRefs" href="#bib0255">11,12</a> According to previous studies, it was found that IL-6 exerts its action via the activation of the JAK/STAT (Janus kinase/signal transducer and activator of transcription) and MAPK (mitogenactivated protein kinase) cascades.<a class="elsevierStyleCrossRefs" href="#bib0255">11,13</a>Previous studies have found four types of epigenetic mechanisms, which are responsible for regulating the expression of genes including: DNA methylation, histone modification, non-coding RNAs (nc RNAs) and chromatin remodeling.<a class="elsevierStyleCrossRefs" href="#bib0270">14–16</a> DNA methylation is an epigenetic alteration that efficiently controls gene expression via gene silencing, and may significantly contribute to the risks of many multiplex diseases, including cancer, autoimmune disease, and metabolic disorders.<a class="elsevierStyleCrossRefs" href="#bib0280">16–18</a> Recent researches of cytokine's gene expression have focused on the epigenetic alterations, because the DNA methylation status at CpG sites is often related with cytokine expression changes.<a class="elsevierStyleCrossRef" href="#bib0295">19</a> Decreasing of methylation is related with chromatin's open position, but increasing of methylation corresponds to chromatin's closed status.<a class="elsevierStyleCrossRef" href="#bib0300">20</a> Then, the extent to which CpG islands methylation is associated with the level of cytokine expression. Thus, we questioned whether DNA methylation of IL-6 is reduced in BD T cells with modifying transcription factor recruitment.Proinflammatory and anti-inflammatory agents are involved in the beginning and development of BD; thus, a comprehensive survey of the regulatory mechanism for the production of cytokines during the progression of BD is the most importance challenge. IL-6 produced mainly by monocytes, B cells, T helper type 2 (Th2) and endothelial cells and plays an essential role in encouraging inflammation and stimulating the immune response.<a class="elsevierStyleCrossRef" href="#bib0305">21</a> Also, the production of IL-6 in the joint tissues is usually done in response to interleukin-1 beta (IL-1β) and tumor necrosis factor alpha (TNF-α) and is mostly performed by chondrocytes, osteoblasts, macrophages, and adipocytes.<a class="elsevierStyleCrossRefs" href="#bib0310">22,23</a> Also, IL-6 is an important cytokine in BD pathogenesis as well as it plays a key role in differentiation of CD4+ T cells to Th17 cells.<a class="elsevierStyleCrossRef" href="#bib0320">24</a> IL-6 is an inflammatory cytokine that has been associated in several immune-mediated inflammatory diseases.<a class="elsevierStyleCrossRef" href="#bib0325">25</a> IL-6 can encourage inflammation by increasing the production of inflammatory cytokines such as TNF-α, IL-1β and other agents. In addition, this cytokine plays a key role by inhibiting the anti-inflammatory cytokines and interleukin-1 receptor antagonists (IL-1Ra) production.<a class="elsevierStyleCrossRefs" href="#bib0330">26,27</a>Evidence has indicated that IL-6 is involved in the pathogenesis of autoimmune disease. In this study, we analyzed the IL-6 expression in patient with BD in comparison with healthy groups. Also, we evaluated the methylation level of interleukin-6 in both healthy and patient groups.Methods and materialsPatients and healthy controls study groupAll specimens presented their written informed agreement for this study, and the study protocol was permitted by the ethics committee of Tabriz University of Medical Sciences, Tabriz, Iran (Permit Number: TBZMED.REC.1394.640). The study group consisted of 51 Iranian patients with BD (61.7% men and 38.3% women), range 16–60 years and 61 healthy candidates. The analysis of BD was based on the international study group criteria for BD.<a class="elsevierStyleCrossRef" href="#bib0340">28</a> Features of the patients were evaluated at the time of diagnosis. The control group composed of 61 healthy subjects who were matched with age, gender, and ethnic of patients (59% men versus 41% women). Healthy participants had no clinical or laboratory signs of autoimmune or inflammatory diseases.DNA, RNA isolation and RT-PCR methodPeripheral blood mononuclear cells (PBMCs) were extracted from EDTA blood tubes by Ficoll (Lymphodex, Inno -Train, Germany) density-gradient centrifugation and directly stored at −80°C until use. Genomic DNA samples of BD and healthy controls were isolated by using the rapid genomic DNA extraction (RGDE) method from the peripheral blood collected in tubes containing EDTA.<a class="elsevierStyleCrossRef" href="#bib0345">29</a> Total RNA was extracted from the PBMCs according to the protocol of TRIzol (Invitrogen, San Diego, CA), followed by reverse transcription using the reverse transcription reagent kit (Thermo Fisher scientific, USA). Then, purity and concentration of total RNA were estimated by nanodrop ND1000 and at 260–280nm purity of RNAs were assessed. The entirety of total RNA was showed by gel electrophoresis of the individual samples on a 1% agarose gel.Primer designIL-6 gene sequence and data about promoter were picked up from the National Center for Biotechnology Information (NCBI) and eukaryotic promoter database (EPD). For IL-6 mRNA sequence, the primer pairs were designed using OLIGO7 Software, (Molecular Biology Insights, Inc., Cascade, CO., USA) and MethPrimer online software. (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>) Also, IL-6 gene Promoter CpG islands were predicted with eukaryotic promoter database (EPD). One pairs of IL-6 primer were designed using PrimerQuest tool to amplify CpG islands of TSS (transcription start site) upstream (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>).<elsevierMultimedia ident="tbl0005"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia>Real-time PCRPeripheral blood mononuclear cells (PBMCs) were extracted from EDTA blood tubes by Ficoll (Lymphodex, Inno -Train, Germany) density-gradient centrifugation. Total RNA was extracted from the PBMCs using TRIzol (Invitrogen, San Diego, CA), followed by reverse transcription using the reverse transcription reagent kit (thermofisher Scientific, USA) and then the expression of IL-10 was measured by MIC real-time instrument (Bio Molecular Systems, AUSTRALIA). The following sequences of the sense and antisense primers of IL-6 were used: forward 5′-GCAGAAAACAACCTGAACC-3′ and reverse 5′-GCTTGTTCCTCACTACTCTC-3′. β-Actin was chosen as the internal reference for expression and copy number variation detection and its expression was evaluated by the following primers in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. Relative expression levels of IL-6 were calculated using the ΔΔCt formula. All tests were performed in at three biological repeats.Methylated DNA immunoprecipitation assessmentOne pair of primers were designed using Primer Quest Tool and methMarker (PREMIER Biosoft, CA, USA) to amplify CpG islands of TSS (transcription start site) upstream (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>). Methylated DNA immunoprecipitation (MeDIP) was performed using EpiQuik™ MeDIP Ultra Kit (Epigentek, Farmingdale, NY, USA). This Kit contains all components essential for doing a successful MeDIP procedure using DNA extracted from PBMCs such as a methylated DNA (mDNA) control and an unmethylated DNA (unDNA) control and control primers that can be used with the control DNA to exhibit the enrichment efficacy and specificity for methylated DNA. The extracted DNA is sonicated to produce random fragments ranging in size from 200 to 800bp using the BANDELIN sonicator (UVV: 3200, Germany) for 15 cycles of 20s on/20s off. Fragment size was confirmed by electrophoresis on a 1.5% agarose gel (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>). Then, 1μg of DNA is used for following MeDIP enrichment. This method was performed by 5μg of fragmented genomic DNA was diluted to 400μl in TE buffer and DNA was denatured at 95°C for 5min followed by immediate cooling on ice for 5min.<elsevierMultimedia ident="fig0010"></elsevierMultimedia>MeDIP-QPCR amplification was carried out using 1μl of eluted DNA in a 20μl PCR reaction along with primer sets. The assays were performed in three replicates and relative methylation fold change was measured for each sample with FE% method which is referred to below. QPCR cycles and the timing steps include an activation cycle, a denaturation cycle at 95°C for 2min and 40 cycles of extension at 95°C for 10s, 54°C for 30s, and finally 72°C for 20s.The fold enrichment (FE) of IL-6 fragments was calculated using a formula described in manufacture protocol of this kit using a ratio of amplification efficiency of the MeDIP sample over that of non-immune IgG:<elsevierMultimedia ident="eq0005"></elsevierMultimedia>Statistical analysisStatistical analysis was performed using SPSS software version 17.0 (SPSS, Chicago, IL, USA). Normal distributions were tested with the Kolmogorov–Smirnov test with Lilliefors correction. Quantitative data were presented as mean±standard deviation (SD). The differences in mRNA and serum levels of IL-6 between control and BD groups were evaluated by Mann–Whitney U test. p-Value <0.05 was considered as significant difference.ResultsSubject characteristicsPatient's characteristics are shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>. The patient group consisted of 29 males and 18 females, with a mean age of 38.02±10.25 years. The control subjects included 37 males and 24 females and had a mean age of 37.4±8.5 years. No significant difference was observed in age between patients with BD and controls (p>0.05).<elsevierMultimedia ident="tbl0010"></elsevierMultimedia>Real-time quantitative PCR for IL-6 geneIn order to compare the level of interleukin-6 (IL-6) gene expression in two groups of BD and healthy subjects, an independent T-test was adopted, taking into consideration the data obtained by employing Kolmogorov–Smirnov test, was normal (p-value >0.05). The obtained results were indicative of significant difference between two groups (p-value <0.05). As we expected, the level of gene expression showed increase in BD individuals group in comparison with healthy group (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>). Also in the patient groups, we analyzed the relationship between gene expression and clinical features. As the results indicated, the gene expression level of IL-6 was significantly different in phlebitis section that is shown as bold in table. Interleukin-6 gene expression was also significantly increased in individuals with positive phlebitis (p-value <0.05) (<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>).<elsevierMultimedia ident="fig0015"></elsevierMultimedia>Methylation status and mRNA expressionWe evaluated the association between the methylation pattern of the IL-6 gene and mRNA expression. The mRNA (1.7±1.3 versus 0.77±1.14, p<0.05) of IL6 was significantly higher in the patients with BD than healthy groups. Also, in order to compare the methylation status of interleukin-6 (IL-6 in two groups of BD and healthy individuals, an independent T-test was adopted, taking into consideration the data obtained by employing Kolmogorov–Smirnov test, was normal (p-value >0.05). The results showed that there was a statistical difference between both groups in terms of methylation rate of interleukin-6 gene (p-value <0.001). In line with our expectations, the methylation ratio of IL-6 revealed decrease in BD individuals group in comparison with healthy group (0.7±0.08 versus 0.77±0.09) (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>).<elsevierMultimedia ident="fig0020"></elsevierMultimedia>Also in the patient groups, we analyzed the relationship between methylation level and clinical features. As the results showed, the methylation levels had significant differences in the arthritis section. In addition, the methylation level of IL-6 was lower in positive group of arthritis than the negative value (p-value <0.05) (<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>).DiscussionBehcet's disease (BD) is an autoinflammatory disease of unknown etiology. Cytokines involved can be classified as Th1, Th2, Th17, Treg types, chemokines and others proinflammatory agents. The cytokine network plays an important role in the pathogenesis of diseases, especially autoimmune disorders, as well in the formation and progression of lesions of the organism and may be blocked by one of the basic links of cytokines, which in turn may obtain the critical clues to view the target therapy program of cytokine in BD.<a class="elsevierStyleCrossRef" href="#bib0350">30</a>Chronic inflammation and responses creates a main mechanism for autoimmune disease. The definite pathways by which the inflammation causes autoimmune are not completely recognized. IL-6 is a multifunctional cytokine produced and released by inflammatory cells and can trigger intracellular transcription factors leading to gene expression, cell division, apoptosis processes and inflammation response.<a class="elsevierStyleCrossRefs" href="#bib0325">25,31,32</a> Persistent differences in the production of IL-6 have been identified among different individuals in various populations with polymorphism at the end of 5′ region<a class="elsevierStyleCrossRef" href="#bib0365">33</a> and the genetic associations of IL-6 polymorphism have been identified with rates of infections, inflammation and immune diseases. This suggested that the production rate of this cytokine is a risk factor for most diseases and their condition.<a class="elsevierStyleCrossRef" href="#bib0370">34</a> However, to date, the role of epigenetic variable has not been reported in IL-6 gene on Behçet's disease.There are some findings indicated that IL-6 may stimulate immune response through the effect on the expression of effective genes by altering patterns of DNA methylation.<a class="elsevierStyleCrossRef" href="#bib0375">35</a> On the other hand, IL-6 production is regulated by methylation of the IL-6 gene promoter.<a class="elsevierStyleCrossRef" href="#bib0375">35</a> DNA demethylation is a property of transcriptionally active genes, and our results are fit with the view that the level of methylation is essential in the regulation of the IL-6 production in patients with BD and could participate in production of this cytokine as seen in BD and other autoimmune disease.<a class="elsevierStyleCrossRefs" href="#bib0375">35,36</a>In a study of 51 BD patients aged 16–60y, we examined the level of promoter methylation of IL-6 in association with demographic and clinical risk factors such as gender and severe BD as well as inflammation markers. As the results showed, the gene expression level of IL-6 was significantly different in phlebitis section. IL-6 gene expression was also significantly increased in individuals with positive phlebitis. Furthermore, in order to compare the methylation status of IL-6 in two groups of BD and healthy individuals, the results showed that there was a statistical significant difference between both groups in terms of methylation rate of IL-6 gene (p-value <0.001). According to our results, there was no relationship between the gene expression and its methylation in different parts of the clinical profile. One of the possible reasons for these results is that our population sample size was small, and if we selected a larger population size, our results may be more meaningful.Epigenetic differences, especially the level of IL-6 methylation between BD patients and healthy group, can be an initial manifestation suggested an increased risk of BD prevalence with the low methylation level of IL-6 promoter. On the other hand, this difference can be considered as a main manipulation for BD prevention or treatment.Scientists from China reported in previous studies that a significantly higher level of IL-6 in cerebrospinal fluid (CSF) had been detected in Chinese patients with active BD with central nervous system (CNS) involvement.<a class="elsevierStyleCrossRef" href="#bib0385">37</a> Also, in a previous study about the methylation level of the IL-6 promoter in patients with RA in comparison with healthy groups, the results indicated that a single CpG site at -1,181 was considerably less methylated in subjects with rheumatoid arthritis (RA).<a class="elsevierStyleCrossRef" href="#bib0375">35</a> Some pioneering studies demonstrated that dysregulation of immune system is related to aging. Furthermore, these results revealed that the level of IL-6 expression was intensified with age in animals model such as mice.<a class="elsevierStyleCrossRef" href="#bib0390">38</a> It has also been shown that the level of IL-6 are much higher in serum, synovial fluid and synovial tissue in patients with severe RA compared with subjects without inflammatory arthritis which indicates that it is related to the activity of disease.<a class="elsevierStyleCrossRef" href="#bib0395">39</a> Some contradictory results reported in previous studies. A decrease or no effect of age on IL-6 production had been shown already.<a class="elsevierStyleCrossRef" href="#bib0400">40</a> According to the results of this clinical study, significant difference could not be seen between patients when dichotomized by age. These diverse results may be caused by the differences in experimental conditions and the health status of subjects in various investigations.These results recommend that the level of methylation in promoter region of gene may be a key mechanism for regulation of IL-6 gene expression in BD and IL-6 CpG island hypomethylation might be involved in the progression of BD. Besides, according to the results, molecular methods such as the analysis of DNA methylation could recognize in early detection by changes in the genotype and genome sequencing. This may be used for early diagnosis and initiation of rapid therapies. Therefore, IL-6 can be used as a molecular marker for the diagnosis of Behcet's patients.ConclusionRegarding the results of expression and methylation of IL-6 in this study, it may be considered that methylation may be as one of the regulatory mechanisms involved in regulating gene expression. Generally, epigenetic alteration such as hypermethylation of IL-6 gene may be a potent therapeutic approach in controlling BD.Conflict of interestThe authors declare that they have no conflicts of interest." "textoCompletoSecciones" => array:1 [ "secciones" => array:11 [ 0 => array:3 [ "identificador" => "xres1348057" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Discussion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1240304" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1348056" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Antecedentes" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Discusión" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1240303" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Methods and materials" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Patients and healthy controls study group" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "DNA, RNA isolation and RT-PCR method" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Primer design" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Real-time PCR" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Methylated DNA immunoprecipitation assessment" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0045" "titulo" => "Results" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0050" "titulo" => "Subject characteristics" ] 1 => array:2 [ "identificador" => "sec0055" "titulo" => "Real-time quantitative PCR for IL-6 gene" ] 2 => array:2 [ "identificador" => "sec0060" "titulo" => "Methylation status and mRNA expression" ] ] ] 7 => array:2 [ "identificador" => "sec0065" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0070" "titulo" => "Conclusion" ] 9 => array:2 [ "identificador" => "sec0075" "titulo" => "Conflict of interest" ] 10 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2017-12-11" "fechaAceptado" => "2018-06-22" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1240304" "palabras" => array:4 [ 0 => "Behçet's disease" 1 => "IL-6" 2 => "MeDIP-qPCR" 3 => "Methylation" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1240303" "palabras" => array:4 [ 0 => "Síndrome de Behçet" 1 => "IL-6" 2 => "MeDIP-qPCR" 3 => "Metilación" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "BackgroundIL-6 mRNA expression is significantly high in many autoimmune diseases such as Behçet's disease; this is often related with more aggressive phenotypes. Nevertheless, the essential molecular process for its high expression has not been completely realized. The aim of this study was undertaken to estimate the gene copy number variation and promoter methylation to IL-6's high expression. MethodsThis study was performed on 51 patients and 61 healthy controls. Initially, DNA and RNA were extracted from all specimens. Promoter methylation levels of IL-6 were evaluated by MeDIP-qPCR technique. Also, IL-6 gene expression was measured by Real-time PCR. After that, we evaluated the relationship between gene expression and methylation, as well as their relationship with clinical specification. ResultsAs we expected, the expression level of IL-6 gene increased significantly in the patient group compared to the healthy subjects. Also, the relative promoter methylation level of the IL-6 mRNA was significantly lower in patient group compared to healthy group (p<0.001). DiscussionWe disclosed that the promoter hypomethylation may be considered as one of the main defects for IL-6 mRNA high expression in patients with Behçet's disease." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Discussion" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "AntecedentesLa expresión de ARNm de IL-6 es significativamente elevada en muchas enfermedades autoinmunes, tales como el síndrome de Behçet, y ello se relaciona a menudo con fenotipos más agresivos. Sin embargo, no se ha comprendido plenamente el proceso molecular esencial para esta expresión elevada. El objetivo de este estudio fue la estimación de la variación del número de copias del gen, y la metilación del promotor de la expresión elevada de IL-6. MétodosEste estudio se realizó en 51 pacientes y 61 controles sanos. Al inicio, se extrajo ADN y ARN de todas las muestras. Se evaluaron los niveles de metilación del promotor de IL-6 mediante la técnica MeDIP-qPCR. También se midió la expresión del gen IL-6 mediante PCR a tiempo real. Tras ello, evaluamos la relación entre la expresión del gen y la metilación, así como su relación con la especificación clínica. ResultadosSegún lo previsto, el nivel de expresión del gen IL-6 se incrementó significativamente en el grupo de pacientes, con respecto a los sujetos sanos. También encontramos que el nivel relativo de metilación del promotor de ARNm de IL-6 fue considerablemente menor en el grupo de pacientes, con respecto al grupo sano (p<0,001). DiscusiónConcluimos que la hipometilación del promotor puede considerarse uno de los defectos principales de la expresión elevada de ARNm de IL-6, en los pacientes con síndrome de Behçet." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Antecedentes" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Discusión" ] ] ] ] "multimedia" => array:7 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 781 "Ancho" => 2500 "Tamanyo" => 135146 ] ] "descripcion" => array:1 [ "en" => "IL-6 promoter methylation. CpG site and island around transcription start site (TSS) were predicted by EPD." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 960 "Ancho" => 1500 "Tamanyo" => 48184 ] ] "descripcion" => array:1 [ "en" => "DNA shearing in gel electrophoresis. Lane (1) 100bp ladder, the extracted DNA is sonicated, load in lanes (3–8) and Lane (2): missed." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1072 "Ancho" => 1529 "Tamanyo" => 43154 ] ] "descripcion" => array:1 [ "en" => "Change fold of IL-6 expression. Regarding the average changes in the expression of the IL-6 gene in the patients and the healthy groups, the amount of it is comparable to that of the healthy group in the patient group, which indicates that IL-6 gene expression was increased among the patients in the patient group." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1083 "Ancho" => 1530 "Tamanyo" => 45647 ] ] "descripcion" => array:1 [ "en" => "Change fold of IL-6 methylation. As shown in the chart, the level of interleukin-6 methylation in the patient group is significantly lower than the healthy group." ] ] 4 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence of primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Product size \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Tm \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL-6 for gene expression \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCAGAAAACAACCTGAACCGCTTGTTCCTCACTACTCTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">164 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">55 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">β-Actin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGTGAAGGTGACAGCAGTTGGGGTGGCTTTTAGGAT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">154 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">55 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL-6 for MeDIP \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCAGGAGAAGATTCCAAAGATGTACGTCGAGGATGTACCGAATTT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">94 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">54 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2313768.png" ] ] ] ] "descripcion" => array:1 [ "en" => "PCR primers and product size." ] ] 5 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "As shown in the table, items that have a statistically significant difference are shown as bold. IL-6: interleukin-6, SD: standard deviation, HLA: Human leukocyte antigen, BD: Behçet's disease, EN: Erythema Nodosum." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Characteristics and clinical features expression \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Frequency \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Change fold of IL-6 expression(mean±SD) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p-Value \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Methylation level of IL-6 expression(mean±SD) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p-Value \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">31 (63%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.5±1.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.13</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.69±0.09 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.76</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">≥45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16 (28%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.1±1.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.71±0.06 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Gender</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Male \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(29) 61.7% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.2±1.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.41</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.75±0.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.18</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(18) 38.3% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.05±1.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.72±0.08 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HLA-B5-</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17 (33%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.93±1.32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.36</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.68±0.06 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.31</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 (21%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.35±1.86 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.65±0.09 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HLA-B51</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">8 (15%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.8±1.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.9</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.68±.06 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.5</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 (13%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.7±1.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.65±0.07 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HLA-B27</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 (6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.34±0.46 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.17</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.69±0.03 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.88</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">23 (44%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.88±1.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.68±0.08 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Oral aphtha</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45 (96%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.6±1.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.35</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.08 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.5</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 (4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.6±0.87 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.74±0.04 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Genital ulcer</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">24 (51%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.7±1.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.78</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.68±0.08 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.18</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">23 (49%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.66±1.16 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.71±0.07 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Arthritis</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 (19%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.7±1.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.97</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.08 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.04</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">38 (81%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.7±1.17 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.74±0.05 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sever B.D.</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30 (64%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.5±1.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.41</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.69±0.08 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.41</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17 (36%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.91±1.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.71±0.08 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Severe eye involvement</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 (22%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.7±1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.9</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.06 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.64</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">36 (78%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.7±1.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.08 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">EN</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7 (16%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.5±1.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.62</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.94</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">38 (84%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.8±1.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.07 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Phlebitis</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 (11%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.7±0.97 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.04</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.74±0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.29</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">41 (89%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.6±1.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.08 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Ocular</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">No eye involvement \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">11 (23%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.7±0.8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="3" align="char" valign="middle">0.44</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.75±0.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="3" align="char" valign="middle">0.26</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">One eye activity \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15 (33%)) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.1±1.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.67±0.07 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Bilateral activity \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">21 (44%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.4±1.7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.07 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cataract</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 (19%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.1±1.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.28</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.69±0.07 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.84</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">36 (74%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.6±1.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.08 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Vision loss</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">One eye \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 (13%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.69±1.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.84</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.67±0.08 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " rowspan="2" align="char" valign="middle">0.45</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">No eye \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">38 (77%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.78±1.34 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.7±0.08 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2313767.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Clinical profile of patients with IL-6 gene expression and its methylation." ] ] 6 => array:5 [ "identificador" => "eq0005" "tipo" => "MULTIMEDIAFORMULA" "mostrarFloat" => false "mostrarDisplay" => true "Formula" => array:5 [ "Matematica" => "FE%=2(IgG CT−Sample CT)×100%" "Fichero" => "STRIPIN_si1.jpeg" "Tamanyo" => 1600 "Alto" => 14 "Ancho" => 203 ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:40 [ 0 => array:3 [ "identificador" => "bib0205" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Behçet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S. Hirohata" 1 => "H. Kikuchi" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Arthritis Res Ther" "fecha" => "2003" "volumen" => "5" "paginaInicial" => "139" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0210" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epidemiology of Behçet's syndrome and regional differences in disease expression. Behçet's syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "S. Yurdakul" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "fecha" => "2010" "paginaInicial" => "35" "paginaFinal" => "52" "editorial" => "Springer" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0215" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of a susceptibility locus in STAT4 for Behçet's disease in Han Chinese in a genome-wide association study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Hou" 1 => "Z. Yang" 2 => "L. Du" 3 => "Z. Jiang" 4 => "Q. Shu" 5 => "Y. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Arthritis Rheumatol" "fecha" => "2012" "volumen" => "64" "paginaInicial" => "4104" "paginaFinal" => "4113" "itemHostRev" => array:3 [ "pii" => "S0378512216304029" "estado" => "S300" "issn" => "03785122" ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0220" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Vitamin D receptor gene polymorphisms in Iranian Azary patients with Behçet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Kolahi" 1 => "A. Khabbazi" 2 => "H. Khodadadi" 3 => "M. Estiar" 4 => "M. Hajialiloo" 5 => "L. Emrahi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3109/03009742.2014.945477" "Revista" => array:6 [ "tituloSerie" => "Scand J Rheumatol" "fecha" => "2015" "volumen" => "44" "paginaInicial" => "163" "paginaFinal" => "167" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25421258" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0225" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Upregulated IL-23 and IL-17 in Behçet patients with active uveitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "W. Chi" 1 => "X. Zhu" 2 => "P. Yang" 3 => "X. Liu" 4 => "X. Lin" 5 => "H. Zhou" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Investig Ophthalmol Vis Sci" "fecha" => "2008" "volumen" => "49" "paginaInicial" => "3058" "paginaFinal" => "3064" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0230" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genome-wide association studies identify IL23R-IL12RB2 and IL10 as Behçet's disease susceptibility loci" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N. Mizuki" 1 => "A. Meguro" 2 => "M. Ota" 3 => "S. Ohno" 4 => "T. Shiota" 5 => "T. Kawagoe" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Nat Genet" "fecha" => "2010" "volumen" => "42" "paginaInicial" => "703" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0235" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A single nucleotide polymorphism in the FOXP3 gene associated with Behcet's disease in an Iranian population" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Hosseini" 1 => "D. Shanehbandi" 2 => "M.A. Estiar" 3 => "S. Gholizadeh" 4 => "A. Khabbazi" 5 => "H. Khodadadi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.7754/clin.lab.2015.150433" "Revista" => array:7 [ "tituloSerie" => "Clin Lab" "fecha" => "2015" "volumen" => "61" "paginaInicial" => "1897" "paginaFinal" => "1903" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26882813" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0025619617308339" "estado" => "S300" "issn" => "00256196" ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0240" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of interleukin-2, interleukin-4 and transforming growth factor-beta gene polymorphisms with Behcet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Shahram" 1 => "E. Nikoopour" 2 => "N. Rezaei" 3 => "K. Saeedfar" 4 => "N. Ziaei" 5 => "F. Davatchi" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Clin Exp Rheumatol" "fecha" => "2011" "volumen" => "29" "numero" => "Suppl. 67" "paginaInicial" => "S28" "paginaFinal" => "S31" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21640045" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0245" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Decreased interleukin 27 expression is associated with active uveitis in Behçet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "C. Wang" 1 => "Y. Tian" 2 => "Z. Ye" 3 => "A. Kijlstra" 4 => "Y. Zhou" 5 => "P. Yang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/ar4570" "Revista" => array:5 [ "tituloSerie" => "Arthritis Res Ther" "fecha" => "2014" "volumen" => "16" "paginaInicial" => "R117" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24887071" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0250" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serum levels of TNF-α, sIL-2R, IL-6, and IL-8 are increased and associated with elevated lipid peroxidation in patients with Behçet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C. Evereklioglu" 1 => "H. Er" 2 => "Y. Türköz" 3 => "M. Çekmen" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Mediat Inflamm" "fecha" => "2002" "volumen" => "11" "paginaInicial" => "87" "paginaFinal" => "93" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0255" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Principles of interleukin (IL)-6-type cytokine signalling and its regulation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "P.C. Heinrich" 1 => "I. Behrmann" 2 => "H. Serge" 3 => "H.M. Hermanns" 4 => "G. Müller-Newen" 5 => "F. Schaper" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1042/BJ20030407" "Revista" => array:7 [ "tituloSerie" => "Biochem J" "fecha" => "2003" "volumen" => "374" "paginaInicial" => "1" "paginaFinal" => "20" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12773095" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0167527315300796" "estado" => "S300" "issn" => "01675273" ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0260" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cytokines in Behcet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "N. Sayinalp" 1 => "O. Ozcebe" 2 => "O. Ozdemir" 3 => "I. Haznedaroğlu" 4 => "S. Dündar" 5 => "S. Kirazli" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Rheumatol" "fecha" => "1996" "volumen" => "23" "paginaInicial" => "321" "paginaFinal" => "322" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8882039" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0265" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "P.C. Heinrich" 1 => "I. Behrmann" 2 => "G. Müller-Newen" 3 => "F. Schaper" 4 => "L. Graeve" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Biochem J" "fecha" => "1998" "volumen" => "334" "paginaInicial" => "297" "paginaFinal" => "314" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0270" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epigenetic modifications of interleukin-6 in synovial fibroblasts from osteoarthritis patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Yang" 1 => "S. Zhou" 2 => "C. Wang" 3 => "Y. Huang" 4 => "H. Li" 5 => "Y. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/srep43592" "Revista" => array:5 [ "tituloSerie" => "Sci Rep" "fecha" => "2017" "volumen" => "7" "paginaInicial" => "43592" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28262826" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0275" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "KLF4 modulates expression of IL-6 in dendritic cells via both promoter activation and epigenetic modification" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.M. Rosenzweig" 1 => "J.D. Glenn" 2 => "P.A. Calabresi" 3 => "K.A. Whartenby" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Biol Chem" "fecha" => "2013" "volumen" => "288" "paginaInicial" => "23868" "paginaFinal" => "23874" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0280" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epigenetic alterations in chronic disease focusing on Behçet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Alipour" 1 => "M. Nouri" 2 => "E. Sakhinia" 3 => "N. Samadi" 4 => "N. Roshanravan" 5 => "A. Ghavami" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.biopha.2017.04.106" "Revista" => array:6 [ "tituloSerie" => "Biomed Pharmacother" "fecha" => "2017" "volumen" => "91" "paginaInicial" => "526" "paginaFinal" => "533" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28482290" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0285" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A gene hypermethylation profile of human cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Esteller" 1 => "P.G. Corn" 2 => "S.B. Baylin" 3 => "J.G. Herman" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Cancer Res" "fecha" => "2001" "volumen" => "61" "paginaInicial" => "3225" "paginaFinal" => "3229" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11309270" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0290" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mechanisms of disease: the developmental origins of disease and the role of the epigenotype" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S.E. Ozanne" 1 => "M. Constância" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Nat Rev Endocrinol" "fecha" => "2007" "volumen" => "3" "paginaInicial" => "539" "itemHostRev" => array:3 [ "pii" => "S0140673614617748" "estado" => "S300" "issn" => "01406736" ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0295" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Methylation and demethylation in the regulation of genes, cells, and responses in the immune system" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "D.R. Fitzpatrick" 1 => "C.B. Wilson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s1521-6616(03)00205-5" "Revista" => array:6 [ "tituloSerie" => "Clin Immunol" "fecha" => "2003" "volumen" => "109" "paginaInicial" => "37" "paginaFinal" => "45" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14585274" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0300" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of a coordinate regulator of interleukins 4, 13, and 5 by cross-species sequence comparisons" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G.G. Loots" 1 => "R.M. Locksley" 2 => "C.M. Blankespoor" 3 => "Z.-E. Wang" 4 => "W. Miller" 5 => "E.M. Rubin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1126/science.288.5463.136" "Revista" => array:6 [ "tituloSerie" => "Science" "fecha" => "2000" "volumen" => "288" "paginaInicial" => "136" "paginaFinal" => "140" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10753117" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0305" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IL-6: a regulator of the transition from neutrophil to monocyte recruitment during inflammation" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "G. Kaplanski" 1 => "V. Marin" 2 => "F. Montero-Julian" 3 => "A. Mantovani" 4 => "C. Farnarier" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s1471-4906(02)00013-3" "Revista" => array:6 [ "tituloSerie" => "Trends Immunol" "fecha" => "2003" "volumen" => "24" "paginaInicial" => "25" "paginaFinal" => "29" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12495721" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0310" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interleukin-1β induces synthesis and secretion of interleukin-6 in human chondrocytes" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Bender" 1 => "H.-D. Haubeck" 2 => "E. Van de Leur" 3 => "G. Dufhues" 4 => "X. Schiel" 5 => "J. Lauwerijns" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "FEBS Lett" "fecha" => "1990" "volumen" => "263" "paginaInicial" => "321" "paginaFinal" => "324" ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0315" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J. Bondeson" 1 => "S.D. Wainwright" 2 => "S. Lauder" 3 => "N. Amos" 4 => "C.E. Hughes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/ar2099" "Revista" => array:5 [ "tituloSerie" => "Arthritis Res Ther" "fecha" => "2006" "volumen" => "8" "paginaInicial" => "R187" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17177994" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0320" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interactions between IL17A, IL23R, and STAT4 polymorphisms confer susceptibility to intestinal Behcet's disease in Korean population" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E.S. Kim" 1 => "S.W. Kim" 2 => "C.M. Moon" 3 => "J.J. Park" 4 => "T.I. Kim" 5 => "W.H. Kim" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.lfs.2012.03.017" "Revista" => array:7 [ "tituloSerie" => "Life Sci" "fecha" => "2012" "volumen" => "90" "paginaInicial" => "740" "paginaFinal" => "746" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22483685" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0002914916305616" "estado" => "S300" "issn" => "00029149" ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0325" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IL-6 in autoimmune disease and chronic inflammatory proliferative disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "K. Ishihara" 1 => "T. Hirano" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/s1359-6101(02)00027-8" "Revista" => array:6 [ "tituloSerie" => "Cytokine Growth Factor Rev" "fecha" => "2002" "volumen" => "13" "paginaInicial" => "357" "paginaFinal" => "368" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12220549" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0330" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IL-6 is an antiinflammatory cytokine required for controlling local or systemic acute inflammatory responses" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Z. Xing" 1 => "J. Gauldie" 2 => "G. Cox" 3 => "H. Baumann" 4 => "M. Jordana" 5 => "X.-F. Lei" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI1368" "Revista" => array:5 [ "tituloSerie" => "J Clin Investig" "fecha" => "1998" "volumen" => "101" "paginaInicial" => "311" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9435302" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0335" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interleukin 1 receptor antagonist (IL-1Ra) is an acute-phase protein" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C. Gabay" 1 => "M.F. Smith" 2 => "D. Eidlen" 3 => "W.P. Arend" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI119488" "Revista" => array:5 [ "tituloSerie" => "J Clin Investig" "fecha" => "1997" "volumen" => "99" "paginaInicial" => "2930" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9185517" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0340" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Validation of the International Study Group criteria for Behçet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T. O’Neill" 1 => "A. Rigby" 2 => "A. Silman" 3 => "C. Barnes" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rheumatology" "fecha" => "1994" "volumen" => "33" "paginaInicial" => "115" "paginaFinal" => "117" ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0345" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Rapid genomic DNA extraction (RGDE)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "S.M. Ali" 1 => "S. Mahnaz" 2 => "T. Mahmood" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Forensic Sci Int: Genet Suppl Ser" "fecha" => "2008" "volumen" => "1" "paginaInicial" => "63" "paginaFinal" => "65" ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0350" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cytokines and Behcet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Z. Zhou" 1 => "S. Chen" 2 => "N. Shen" 3 => "Y. Lu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.autrev.2011.12.005" "Revista" => array:6 [ "tituloSerie" => "Autoimmun Rev" "fecha" => "2012" "volumen" => "11" "paginaInicial" => "699" "paginaFinal" => "704" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22197901" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0355" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interplay between IFN-γ and IL-6 signaling governs neutrophil trafficking and apoptosis during acute inflammation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R.M. McLoughlin" 1 => "J. Witowski" 2 => "R.L. Robson" 3 => "T.S. Wilkinson" 4 => "S.M. Hurst" 5 => "A.S. Williams" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI17129" "Revista" => array:6 [ "tituloSerie" => "J Clin Investig" "fecha" => "2003" "volumen" => "112" "paginaInicial" => "598" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12925700" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1525861013003034" "estado" => "S300" "issn" => "15258610" ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0360" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Roles of STAT3 in mediating the cell growth, differentiation and survival signals relayed through the IL-6 family of cytokine receptors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T. Hirano" 1 => "K. Ishihara" 2 => "M. Hibi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.onc.1203551" "Revista" => array:6 [ "tituloSerie" => "Oncogene" "fecha" => "2000" "volumen" => "19" "paginaInicial" => "2548" "paginaFinal" => "2556" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10851053" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0365" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The effect of novel polymorphisms in the interleukin-6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset juvenile chronic arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Fishman" 1 => "G. Faulds" 2 => "R. Jeffery" 3 => "V. Mohamed-Ali" 4 => "J.S. Yudkin" 5 => "S. Humphries" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI2629" "Revista" => array:5 [ "tituloSerie" => "J Clin Investig" "fecha" => "1998" "volumen" => "102" "paginaInicial" => "1369" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9769329" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0370" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Novel IL-6 haplotypes and disease association" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Fife" 1 => "E. Ogilvie" 2 => "D. Kelberman" 3 => "J. Samuel" 4 => "A. Gutierrez" 5 => "S. Humphries" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.gene.6364186" "Revista" => array:6 [ "tituloSerie" => "Genes Immunity" "fecha" => "2005" "volumen" => "6" "paginaInicial" => "367" "paginaFinal" => "370" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15815691" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0375" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Methylation status of a single CpG site in the IL6 promoter is related to IL6 messenger RNA levels and rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "C.J. Nile" 1 => "R.C. Read" 2 => "M. Akil" 3 => "G.W. Duff" 4 => "A.G. Wilson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Arthritis Rheumatol" "fecha" => "2008" "volumen" => "58" "paginaInicial" => "2686" "paginaFinal" => "2693" ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0380" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interleukin-6 (IL-6) in patients with Behçet's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Yamakawa" 1 => "Y. Sugita" 2 => "T. Nagatani" 3 => "S. Takahashi" 4 => "T. Yamakawa" 5 => "S.-i. Tanaka" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/0923-1811(95)00439-4" "Revista" => array:6 [ "tituloSerie" => "J Dermatol Sci" "fecha" => "1996" "volumen" => "11" "paginaInicial" => "189" "paginaFinal" => "195" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8785169" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0385" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Anticardiolipin antibodies and interleukin-6 in cerebrospinal fluid and blood of Chinese patients with neuro-Behçet's syndrome" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C. Wang" 1 => "C. Chuang" 2 => "C. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Clin Exp Rheumatol" "fecha" => "1991" "volumen" => "10" "paginaInicial" => "599" "paginaFinal" => "602" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1483312" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0390" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Age-associated increase in interleukin 6 in MRL/lpr mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "B. Tang" 1 => "T. Matsuda" 2 => "S. Akira" 3 => "N. Nagata" 4 => "S. Ikehara" 5 => "T. Hirano" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/intimm/3.3.273" "Revista" => array:6 [ "tituloSerie" => "Int Immunol" "fecha" => "1991" "volumen" => "3" "paginaInicial" => "273" "paginaFinal" => "278" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2049341" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0395" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "In situ hybridization of IL-6 in rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "N. Wood" 1 => "J. Symons" 2 => "E. Dickens" 3 => "G. Duff" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2249.1992.tb02972.x" "Revista" => array:6 [ "tituloSerie" => "Clin Exp Immunol" "fecha" => "1992" "volumen" => "87" "paginaInicial" => "183" "paginaFinal" => "189" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1531188" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0400" "etiqueta" => "40" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interleukin-6 production does not increase with age" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A.A. Beharka" 1 => "M. Meydani" 2 => "D. Wu" 3 => "L.S. Leka" 4 => "A. Meydani" 5 => "S.N. Meydani" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Gerontol Ser A: Biol Sci Med Sci" "fecha" => "2001" "volumen" => "56" "paginaInicial" => "B81" "paginaFinal" => "B88" ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/1699258X/0000001600000003/v1_202006131050/S1699258X18301244/v1_202006131050/en/main.assets" "Apartado" => array:4 [ "identificador" => "17499" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/1699258X/0000001600000003/v1_202006131050/S1699258X18301244/v1_202006131050/en/main.pdf?idApp=UINPBA00004M&text.app=https://reumatologiaclinica.org/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X18301244?idApp=UINPBA00004M"]

Estadísticas

Original Article

Methylation status of interleukin-6 gene promoter in patients with Behçet's disease

Estatus de la metilación del promotor del gen interleucina-6 en pacientes con síndrome de Behçet

Shahriar Alipoura,b, Ebrahim Sakhiniac, Alireza Khabbazib, Nasser Samadid, Zohreh Babalooe, Mahdi Azadf, Somayeh Abolhasanig, Jafar Farhadia,b, Golamreza Jadideslama,b, Neda Roshanravanh, Mohammad Nouric,

Autor para correspondencia

nourimd@yahoo.com

Corresponding author.

a Molecular Medicine, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Iran

b Connective Tissue Diseases Research Center, Tabriz University of Medical Science, Iran

c Department of Biochemistry, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran

d Cancer Biochemistry, Cancer Biotechnology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran

e Department of Immunology Medicine Faculty, Tabriz University of Medical Sciences, Tabriz, Iran

f Department of Medical Laboratory Sciences, Faculty of Allied Medicine, Qazvin University of Medical Sciences, Qazvin, Iran

g Faculty of Dentistry, Tabriz University of Medical Sciences, Tabriz, Iran

h Cardiovascular Research Center, Tabriz University of Medical Sciences, Tabriz, Iran

Leído

6026

Veces
se ha leído el artículo

1954

Total PDF

4072

Total HTML

Compartir estadísticas

 array:22 [
  "pii" => "S1699258X18301244"
  "issn" => "1699258X"
  "doi" => "10.1016/j.reuma.2018.06.006"
  "estado" => "S300"
  "fechaPublicacion" => "2020-05-01"
  "aid" => "1241"
  "copyrightAnyo" => "2018"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Reumatol Clin. 2020;16:229-34"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 238
    "formatos" => array:3 [
      "EPUB" => 29
      "HTML" => 89
      "PDF" => 120
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S1699258X18301220"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2018.06.004"
    "estado" => "S300"
    "fechaPublicacion" => "2020-05-01"
    "aid" => "1239"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46; and Sociedad Espa&#241;ola de Reumatolog&#237;a y Colegio Mexicano de Reumatolog&#237;a"
    "documento" => "simple-article"
    "crossmark" => 1
    "subdocumento" => "crp"
    "cita" => "Reumatol Clin. 2020;16:235-8"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 326
      "formatos" => array:3 [
        "EPUB" => 40
        "HTML" => 166
        "PDF" => 120
      ]
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Brief Report</span>"
      "titulo" => "Elderly-onset sarcoidosis&#58; A single center comparative study"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "235"
          "paginaFinal" => "238"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Estudio comparativo entre la sarcoidosis de inicio en la edad adulta y en la tercera edad&#46; An&#225;lisis de 131 casos"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Senol Kobak, Fidan Yildiz, Huseyin Semiz, Mehmet Orman"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Senol"
              "apellidos" => "Kobak"
            ]
            1 => array:2 [
              "nombre" => "Fidan"
              "apellidos" => "Yildiz"
            ]
            2 => array:2 [
              "nombre" => "Huseyin"
              "apellidos" => "Semiz"
            ]
            3 => array:2 [
              "nombre" => "Mehmet"
              "apellidos" => "Orman"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X18301220?idApp=UINPBA00004M"
    "url" => "/1699258X/0000001600000003/v1_202006131050/S1699258X18301220/v1_202006131050/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1699258X18301256"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2018.06.007"
    "estado" => "S300"
    "fechaPublicacion" => "2020-05-01"
    "aid" => "1242"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46; and Sociedad Espa&#241;ola de Reumatolog&#237;a y Colegio Mexicano de Reumatolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Reumatol Clin. 2020;16:222-8"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 690
      "formatos" => array:3 [
        "EPUB" => 38
        "HTML" => 466
        "PDF" => 186
      ]
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "Eficacia y seguridad de los glucocorticoides en la artritis reumatoide&#58; revisi&#243;n sistem&#225;tica de la literatura"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "222"
          "paginaFinal" => "228"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Efficacy and safety of glucocorticoids in rheumatoid arthritis&#58; Systematic literature review"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Figura 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1001
              "Ancho" => 1544
              "Tamanyo" => 100506
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Diagrama de flujo de los estudios&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Raimon Sanmart&#237;, Jes&#250;s Tornero, Javier Narv&#225;ez, Alejandro Mu&#241;oz, Elena Garmendia, Ana M&#46; Ortiz, Miguel Angel Abad, Patricia Moya, Mar&#237;a Lourdes Mateo, Delia Reina, Juan Salvatierra-Ossorio, Sergio Rodriguez, Natalia Palmou-Fontana, Ana Ruibal-Escribano, Jaime Calvo-Al&#233;n"
          "autores" => array:15 [
            0 => array:2 [
              "nombre" => "Raimon"
              "apellidos" => "Sanmart&#237;"
            ]
            1 => array:2 [
              "nombre" => "Jes&#250;s"
              "apellidos" => "Tornero"
            ]
            2 => array:2 [
              "nombre" => "Javier"
              "apellidos" => "Narv&#225;ez"
            ]
            3 => array:2 [
              "nombre" => "Alejandro"
              "apellidos" => "Mu&#241;oz"
            ]
            4 => array:2 [
              "nombre" => "Elena"
              "apellidos" => "Garmendia"
            ]
            5 => array:2 [
              "nombre" => "Ana M&#46;"
              "apellidos" => "Ortiz"
            ]
            6 => array:2 [
              "nombre" => "Miguel Angel"
              "apellidos" => "Abad"
            ]
            7 => array:2 [
              "nombre" => "Patricia"
              "apellidos" => "Moya"
            ]
            8 => array:2 [
              "nombre" => "Mar&#237;a Lourdes"
              "apellidos" => "Mateo"
            ]
            9 => array:2 [
              "nombre" => "Delia"
              "apellidos" => "Reina"
            ]
            10 => array:2 [
              "nombre" => "Juan"
              "apellidos" => "Salvatierra-Ossorio"
            ]
            11 => array:2 [
              "nombre" => "Sergio"
              "apellidos" => "Rodriguez"
            ]
            12 => array:2 [
              "nombre" => "Natalia"
              "apellidos" => "Palmou-Fontana"
            ]
            13 => array:2 [
              "nombre" => "Ana"
              "apellidos" => "Ruibal-Escribano"
            ]
            14 => array:2 [
              "nombre" => "Jaime"
              "apellidos" => "Calvo-Al&#233;n"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2173574319301169"
        "doi" => "10.1016/j.reumae.2018.06.004"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574319301169?idApp=UINPBA00004M"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X18301256?idApp=UINPBA00004M"
    "url" => "/1699258X/0000001600000003/v1_202006131050/S1699258X18301256/v1_202006131050/es/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "Methylation status of interleukin-6 gene promoter in patients with Beh&#231;et&#39;s disease"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "229"
        "paginaFinal" => "234"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Shahriar Alipour, Ebrahim Sakhinia, Alireza Khabbazi, Nasser Samadi, Zohreh Babaloo, Mahdi Azad, Somayeh Abolhasani, Jafar Farhadi, Golamreza Jadideslam, Neda Roshanravan, Mohammad Nouri"
        "autores" => array:11 [
          0 => array:3 [
            "nombre" => "Shahriar"
            "apellidos" => "Alipour"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Ebrahim"
            "apellidos" => "Sakhinia"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Alireza"
            "apellidos" => "Khabbazi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Nasser"
            "apellidos" => "Samadi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Zohreh"
            "apellidos" => "Babaloo"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Mahdi"
            "apellidos" => "Azad"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0030"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Somayeh"
            "apellidos" => "Abolhasani"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">g</span>"
                "identificador" => "aff0035"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Jafar"
            "apellidos" => "Farhadi"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          8 => array:3 [
            "nombre" => "Golamreza"
            "apellidos" => "Jadideslam"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          9 => array:3 [
            "nombre" => "Neda"
            "apellidos" => "Roshanravan"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">h</span>"
                "identificador" => "aff0040"
              ]
            ]
          ]
          10 => array:4 [
            "nombre" => "Mohammad"
            "apellidos" => "Nouri"
            "email" => array:1 [
              0 => "nourimd@yahoo.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:8 [
          0 => array:3 [
            "entidad" => "Molecular Medicine&#44; Faculty of Advanced Medical Sciences&#44; Tabriz University of Medical Sciences&#44; Iran"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Connective Tissue Diseases Research Center&#44; Tabriz University of Medical Science&#44; Iran"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Biochemistry&#44; Faculty of Medicine&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Cancer Biochemistry&#44; Cancer Biotechnology&#44; Faculty of Medicine&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Department of Immunology Medicine Faculty&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
          5 => array:3 [
            "entidad" => "Department of Medical Laboratory Sciences&#44; Faculty of Allied Medicine&#44; Qazvin University of Medical Sciences&#44; Qazvin&#44; Iran"
            "etiqueta" => "f"
            "identificador" => "aff0030"
          ]
          6 => array:3 [
            "entidad" => "Faculty of Dentistry&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "g"
            "identificador" => "aff0035"
          ]
          7 => array:3 [
            "entidad" => "Cardiovascular Research Center&#44; Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran"
            "etiqueta" => "h"
            "identificador" => "aff0040"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Estatus de la metilaci&#243;n del promotor del gen interleucina-6 en pacientes con s&#237;ndrome de Beh&#231;et"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1083
            "Ancho" => 1530
            "Tamanyo" => 45647
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Change fold of IL-6 methylation&#46; As shown in the chart&#44; the level of interleukin-6 methylation in the patient group is significantly lower than the healthy group&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Behcet&#39;s is an autoinflammatory disease that is defined by Hulusi Behcet in 1937 as an inflammatory process of unknown etiology&#44; characterized by recurrent aphthous stomatitis&#44; uveitis&#44; genital ulcers&#44; and skin lesions&#46;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">1</span></a> Although Beh&#231;et&#39;s disease &#40;BD&#41; is an extensive and worldwide disease in different parts of the world&#44; it has remarkable local differences&#44; with the maximum of incidences in the Mediterranean&#44; the Middle East&#44; and the Far East which was locally called the Silk Road&#46; Most prevalence of Beh&#231;et&#39;s disease has been reported in Turkey including 421 people per 10<span class="elsevierStyleSup">5</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">2</span></a> Among all genetic factors&#44; HLA-B51 has been confirmed as the strongest risk factor for BD&#44; which was verified in various populations&#46; More recently studies have disclosed the association of many non-HLA genes with the BD&#44; such as chemokine receptor 1 &#40;CCR1&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">3</span></a> Vitamin D Receptor &#40;VDR&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">4</span></a> interleukin-23 &#40;IL-23&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">5</span></a> IL-23R and IL-12RB2&#44;<a class="elsevierStyleCrossRefs" href="#bib0215"><span class="elsevierStyleSup">3&#44;6</span></a> fork head box P3 &#40;Foxp3&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">7</span></a> IL-2&#44; IL-4&#44; transforming growth factor &#40;TGF&#41;-beta&#44;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">8</span></a> IL-27<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">9</span></a> and IL-6<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">10</span></a> for BD&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">IL-6 is a multifunctional cytokine with a wide-range of biologic activities such as the regulation of the acute-phase response to infection&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">11</span></a> Dysregulation and dysfunction of IL-6 gene expression contributes to the inception of numerous diseases&#44; such as several types of cancer&#44; autoimmune disease for example rheumatoid arthritis &#40;RA&#41;&#44; type 1 diabetes &#40;T1D&#41;&#44; inflammatory bowel disease &#40;IBD&#41;&#44; multiple sclerosis &#40;MS&#41;&#44; and autoinflammatory disorders such as Beh&#231;et&#39;s disease &#40;BD&#41;&#46;<a class="elsevierStyleCrossRefs" href="#bib0255"><span class="elsevierStyleSup">11&#44;12</span></a> According to previous studies&#44; it was found that IL-6 exerts its action via the activation of the JAK&#47;STAT &#40;Janus kinase&#47;signal transducer and activator of transcription&#41; and MAPK &#40;mitogenactivated protein kinase&#41; cascades&#46;<a class="elsevierStyleCrossRefs" href="#bib0255"><span class="elsevierStyleSup">11&#44;13</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">Previous studies have found four types of epigenetic mechanisms&#44; which are responsible for regulating the expression of genes including&#58; DNA methylation&#44; histone modification&#44; non-coding RNAs &#40;nc RNAs&#41; and chromatin remodeling&#46;<a class="elsevierStyleCrossRefs" href="#bib0270"><span class="elsevierStyleSup">14&#8211;16</span></a> DNA methylation is an epigenetic alteration that efficiently controls gene expression via gene silencing&#44; and may significantly contribute to the risks of many multiplex diseases&#44; including cancer&#44; autoimmune disease&#44; and metabolic disorders&#46;<a class="elsevierStyleCrossRefs" href="#bib0280"><span class="elsevierStyleSup">16&#8211;18</span></a> Recent researches of cytokine&#39;s gene expression have focused on the epigenetic alterations&#44; because the DNA methylation status at CpG sites is often related with cytokine expression changes&#46;<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">19</span></a> Decreasing of methylation is related with chromatin&#39;s open position&#44; but increasing of methylation corresponds to chromatin&#39;s closed status&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">20</span></a> Then&#44; the extent to which CpG islands methylation is associated with the level of cytokine expression&#46; Thus&#44; we questioned whether DNA methylation of IL-6 is reduced in BD T cells with modifying transcription factor recruitment&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">Proinflammatory and anti-inflammatory agents are involved in the beginning and development of BD&#59; thus&#44; a comprehensive survey of the regulatory mechanism for the production of cytokines during the progression of BD is the most importance challenge&#46; IL-6 produced mainly by monocytes&#44; B cells&#44; T helper type 2 &#40;Th2&#41; and endothelial cells and plays an essential role in encouraging inflammation and stimulating the immune response&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">21</span></a> Also&#44; the production of IL-6 in the joint tissues is usually done in response to interleukin-1 beta &#40;IL-1&#946;&#41; and tumor necrosis factor alpha &#40;TNF-&#945;&#41; and is mostly performed by chondrocytes&#44; osteoblasts&#44; macrophages&#44; and adipocytes&#46;<a class="elsevierStyleCrossRefs" href="#bib0310"><span class="elsevierStyleSup">22&#44;23</span></a> Also&#44; IL-6 is an important cytokine in BD pathogenesis as well as it plays a key role in differentiation of CD4&#43; T cells to Th17 cells&#46;<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">24</span></a> IL-6 is an inflammatory cytokine that has been associated in several immune-mediated inflammatory diseases&#46;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">25</span></a> IL-6 can encourage inflammation by increasing the production of inflammatory cytokines such as TNF-&#945;&#44; IL-1&#946; and other agents&#46; In addition&#44; this cytokine plays a key role by inhibiting the anti-inflammatory cytokines and interleukin-1 receptor antagonists &#40;IL-1Ra&#41; production&#46;<a class="elsevierStyleCrossRefs" href="#bib0330"><span class="elsevierStyleSup">26&#44;27</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">Evidence has indicated that IL-6 is involved in the pathogenesis of autoimmune disease&#46; In this study&#44; we analyzed the IL-6 expression in patient with BD in comparison with healthy groups&#46; Also&#44; we evaluated the methylation level of interleukin-6 in both healthy and patient groups&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Methods and materials</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Patients and healthy controls study group</span><p id="par0030" class="elsevierStylePara elsevierViewall">All specimens presented their written informed agreement for this study&#44; and the study protocol was permitted by the ethics committee of Tabriz University of Medical Sciences&#44; Tabriz&#44; Iran &#40;Permit Number&#58; TBZMED&#46;REC&#46;1394&#46;640&#41;&#46; The study group consisted of 51 Iranian patients with BD &#40;61&#46;7&#37; men and 38&#46;3&#37; women&#41;&#44; range 16&#8211;60 years and 61 healthy candidates&#46; The analysis of BD was based on the international study group criteria for BD&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">28</span></a> Features of the patients were evaluated at the time of diagnosis&#46; The control group composed of 61 healthy subjects who were matched with age&#44; gender&#44; and ethnic of patients &#40;59&#37; men versus 41&#37; women&#41;&#46; Healthy participants had no clinical or laboratory signs of autoimmune or inflammatory diseases&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">DNA&#44; RNA isolation and RT-PCR method</span><p id="par0035" class="elsevierStylePara elsevierViewall">Peripheral blood mononuclear cells &#40;PBMCs&#41; were extracted from EDTA blood tubes by Ficoll &#40;Lymphodex&#44; Inno -Train&#44; Germany&#41; density-gradient centrifugation and directly stored at &#8722;80<span class="elsevierStyleHsp" style=""></span>&#176;C until use&#46; Genomic DNA samples of BD and healthy controls were isolated by using the rapid genomic DNA extraction &#40;RGDE&#41; method from the peripheral blood collected in tubes containing EDTA&#46;<a class="elsevierStyleCrossRef" href="#bib0345"><span class="elsevierStyleSup">29</span></a> Total RNA was extracted from the PBMCs according to the protocol of TRIzol &#40;Invitrogen&#44; San Diego&#44; CA&#41;&#44; followed by reverse transcription using the reverse transcription reagent kit &#40;Thermo Fisher scientific&#44; USA&#41;&#46; Then&#44; purity and concentration of total RNA were estimated by nanodrop ND1000 and at 260&#8211;280<span class="elsevierStyleHsp" style=""></span>nm purity of RNAs were assessed&#46; The entirety of total RNA was showed by gel electrophoresis of the individual samples on a 1&#37; agarose gel&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Primer design</span><p id="par0040" class="elsevierStylePara elsevierViewall">IL-6 gene sequence and data about promoter were picked up from the National Center for Biotechnology Information &#40;NCBI&#41; and eukaryotic promoter database &#40;EPD&#41;&#46; For IL-6 mRNA sequence&#44; the primer pairs were designed using OLIGO7 Software&#44; &#40;Molecular Biology Insights&#44; Inc&#46;&#44; Cascade&#44; CO&#46;&#44; USA&#41; and MethPrimer online software&#46; &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41; Also&#44; IL-6 gene Promoter CpG islands were predicted with eukaryotic promoter database &#40;EPD&#41;&#46; One pairs of IL-6 primer were designed using PrimerQuest tool to amplify CpG islands of TSS &#40;transcription start site&#41; upstream &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Real-time PCR</span><p id="par0045" class="elsevierStylePara elsevierViewall">Peripheral blood mononuclear cells &#40;PBMCs&#41; were extracted from EDTA blood tubes by Ficoll &#40;Lymphodex&#44; Inno -Train&#44; Germany&#41; density-gradient centrifugation&#46; Total RNA was extracted from the PBMCs using TRIzol &#40;Invitrogen&#44; San Diego&#44; CA&#41;&#44; followed by reverse transcription using the reverse transcription reagent kit &#40;thermofisher Scientific&#44; USA&#41; and then the expression of IL-10 was measured by MIC real-time instrument &#40;Bio Molecular Systems&#44; AUSTRALIA&#41;&#46; The following sequences of the sense and antisense primers of IL-6 were used&#58; forward 5&#8242;-GCAGAAAACAACCTGAACC-3&#8242; and reverse 5&#8242;-GCTTGTTCCTCACTACTCTC-3&#8242;&#46; &#946;-Actin was chosen as the internal reference for expression and copy number variation detection and its expression was evaluated by the following primers in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46; Relative expression levels of IL-6 were calculated using the &#916;&#916;Ct formula&#46; All tests were performed in at three biological repeats&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Methylated DNA immunoprecipitation assessment</span><p id="par0050" class="elsevierStylePara elsevierViewall">One pair of primers were designed using Primer Quest Tool and methMarker &#40;PREMIER Biosoft&#44; CA&#44; USA&#41; to amplify CpG islands of TSS &#40;transcription start site&#41; upstream &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46; Methylated DNA immunoprecipitation &#40;MeDIP&#41; was performed using EpiQuik&#8482; MeDIP Ultra Kit &#40;Epigentek&#44; Farmingdale&#44; NY&#44; USA&#41;&#46; This Kit contains all components essential for doing a successful MeDIP procedure using DNA extracted from PBMCs such as a methylated DNA &#40;mDNA&#41; control and an unmethylated DNA &#40;unDNA&#41; control and control primers that can be used with the control DNA to exhibit the enrichment efficacy and specificity for methylated DNA&#46; The extracted DNA is sonicated to produce random fragments ranging in size from 200 to 800<span class="elsevierStyleHsp" style=""></span>bp using the BANDELIN sonicator &#40;UVV&#58; 3200&#44; Germany&#41; for 15 cycles of 20<span class="elsevierStyleHsp" style=""></span>s on&#47;20<span class="elsevierStyleHsp" style=""></span>s off&#46; Fragment size was confirmed by electrophoresis on a 1&#46;5&#37; agarose gel &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#46; Then&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;g of DNA is used for following MeDIP enrichment&#46; This method was performed by 5<span class="elsevierStyleHsp" style=""></span>&#956;g of fragmented genomic DNA was diluted to 400<span class="elsevierStyleHsp" style=""></span>&#956;l in TE buffer and DNA was denatured at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min followed by immediate cooling on ice for 5<span class="elsevierStyleHsp" style=""></span>min&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0055" class="elsevierStylePara elsevierViewall">MeDIP-QPCR amplification was carried out using 1<span class="elsevierStyleHsp" style=""></span>&#956;l of eluted DNA in a 20<span class="elsevierStyleHsp" style=""></span>&#956;l PCR reaction along with primer sets&#46; The assays were performed in three replicates and relative methylation fold change was measured for each sample with FE&#37; method which is referred to below&#46; QPCR cycles and the timing steps include an activation cycle&#44; a denaturation cycle at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 2<span class="elsevierStyleHsp" style=""></span>min and 40 cycles of extension at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 10<span class="elsevierStyleHsp" style=""></span>s&#44; 54<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; and finally 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 20<span class="elsevierStyleHsp" style=""></span>s&#46;</p><p id="par0060" class="elsevierStylePara elsevierViewall">The fold enrichment &#40;FE&#41; of IL-6 fragments was calculated using a formula described in manufacture protocol of this kit using a ratio of amplification efficiency of the MeDIP sample over that of non-immune IgG&#58;<elsevierMultimedia ident="eq0005"></elsevierMultimedia></p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Statistical analysis</span><p id="par0065" class="elsevierStylePara elsevierViewall">Statistical analysis was performed using SPSS software version 17&#46;0 &#40;SPSS&#44; Chicago&#44; IL&#44; USA&#41;&#46; Normal distributions were tested with the Kolmogorov&#8211;Smirnov test with Lilliefors correction&#46; Quantitative data were presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>standard deviation &#40;SD&#41;&#46; The differences in mRNA and serum levels of IL-6 between control and BD groups were evaluated by Mann&#8211;Whitney <span class="elsevierStyleItalic">U</span> test&#46; <span class="elsevierStyleItalic">p</span>-Value &#60;0&#46;05 was considered as significant difference&#46;</p></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Results</span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Subject characteristics</span><p id="par0070" class="elsevierStylePara elsevierViewall">Patient&#39;s characteristics are shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; The patient group consisted of 29 males and 18 females&#44; with a mean age of 38&#46;02<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>10&#46;25 years&#46; The control subjects included 37 males and 24 females and had a mean age of 37&#46;4<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;5 years&#46; No significant difference was observed in age between patients with BD and controls &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Real-time quantitative PCR for IL-6 gene</span><p id="par0075" class="elsevierStylePara elsevierViewall">In order to compare the level of interleukin-6 &#40;IL-6&#41; gene expression in two groups of BD and healthy subjects&#44; an independent <span class="elsevierStyleItalic">T</span>-test was adopted&#44; taking into consideration the data obtained by employing Kolmogorov&#8211;Smirnov test&#44; was normal &#40;<span class="elsevierStyleItalic">p</span>-value &#62;0&#46;05&#41;&#46; The obtained results were indicative of significant difference between two groups &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;05&#41;&#46; As we expected&#44; the level of gene expression showed increase in BD individuals group in comparison with healthy group &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41;&#46; Also in the patient groups&#44; we analyzed the relationship between gene expression and clinical features&#46; As the results indicated&#44; the gene expression level of IL-6 was significantly different in phlebitis section that is shown as bold in table&#46; Interleukin-6 gene expression was also significantly increased in individuals with positive phlebitis &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Methylation status and mRNA expression</span><p id="par0080" class="elsevierStylePara elsevierViewall">We evaluated the association between the methylation pattern of the IL-6 gene and mRNA expression&#46; The mRNA &#40;1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;3 versus 0&#46;77<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;14&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; of IL6 was significantly higher in the patients with BD than healthy groups&#46; Also&#44; in order to compare the methylation status of interleukin-6 &#40;IL-6 in two groups of BD and healthy individuals&#44; an independent <span class="elsevierStyleItalic">T</span>-test was adopted&#44; taking into consideration the data obtained by employing Kolmogorov&#8211;Smirnov test&#44; was normal &#40;<span class="elsevierStyleItalic">p</span>-value &#62;0&#46;05&#41;&#46; The results showed that there was a statistical difference between both groups in terms of methylation rate of interleukin-6 gene &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;001&#41;&#46; In line with our expectations&#44; the methylation ratio of IL-6 revealed decrease in BD individuals group in comparison with healthy group &#40;0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08 versus 0&#46;77<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;09&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>&#41;&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia><p id="par0085" class="elsevierStylePara elsevierViewall">Also in the patient groups&#44; we analyzed the relationship between methylation level and clinical features&#46; As the results showed&#44; the methylation levels had significant differences in the arthritis section&#46; In addition&#44; the methylation level of IL-6 was lower in positive group of arthritis than the negative value &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;05&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46;</p></span></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Discussion</span><p id="par0090" class="elsevierStylePara elsevierViewall">Behcet&#39;s disease &#40;BD&#41; is an autoinflammatory disease of unknown etiology&#46; Cytokines involved can be classified as Th1&#44; Th2&#44; Th17&#44; Treg types&#44; chemokines and others proinflammatory agents&#46; The cytokine network plays an important role in the pathogenesis of diseases&#44; especially autoimmune disorders&#44; as well in the formation and progression of lesions of the organism and may be blocked by one of the basic links of cytokines&#44; which in turn may obtain the critical clues to view the target therapy program of cytokine in BD&#46;<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">30</span></a></p><p id="par0095" class="elsevierStylePara elsevierViewall">Chronic inflammation and responses creates a main mechanism for autoimmune disease&#46; The definite pathways by which the inflammation causes autoimmune are not completely recognized&#46; IL-6 is a multifunctional cytokine produced and released by inflammatory cells and can trigger intracellular transcription factors leading to gene expression&#44; cell division&#44; apoptosis processes and inflammation response&#46;<a class="elsevierStyleCrossRefs" href="#bib0325"><span class="elsevierStyleSup">25&#44;31&#44;32</span></a> Persistent differences in the production of IL-6 have been identified among different individuals in various populations with polymorphism at the end of 5&#8242; region<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">33</span></a> and the genetic associations of IL-6 polymorphism have been identified with rates of infections&#44; inflammation and immune diseases&#46; This suggested that the production rate of this cytokine is a risk factor for most diseases and their condition&#46;<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">34</span></a> However&#44; to date&#44; the role of epigenetic variable has not been reported in IL-6 gene on Beh&#231;et&#39;s disease&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">There are some findings indicated that IL-6 may stimulate immune response through the effect on the expression of effective genes by altering patterns of DNA methylation&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">35</span></a> On the other hand&#44; IL-6 production is regulated by methylation of the IL-6 gene promoter&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">35</span></a> DNA demethylation is a property of transcriptionally active genes&#44; and our results are fit with the view that the level of methylation is essential in the regulation of the IL-6 production in patients with BD and could participate in production of this cytokine as seen in BD and other autoimmune disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0375"><span class="elsevierStyleSup">35&#44;36</span></a></p><p id="par0105" class="elsevierStylePara elsevierViewall">In a study of 51 BD patients aged 16&#8211;60<span class="elsevierStyleHsp" style=""></span>y&#44; we examined the level of promoter methylation of IL-6 in association with demographic and clinical risk factors such as gender and severe BD as well as inflammation markers&#46; As the results showed&#44; the gene expression level of IL-6 was significantly different in phlebitis section&#46; IL-6 gene expression was also significantly increased in individuals with positive phlebitis&#46; Furthermore&#44; in order to compare the methylation status of IL-6 in two groups of BD and healthy individuals&#44; the results showed that there was a statistical significant difference between both groups in terms of methylation rate of IL-6 gene &#40;<span class="elsevierStyleItalic">p</span>-value &#60;0&#46;001&#41;&#46; According to our results&#44; there was no relationship between the gene expression and its methylation in different parts of the clinical profile&#46; One of the possible reasons for these results is that our population sample size was small&#44; and if we selected a larger population size&#44; our results may be more meaningful&#46;</p><p id="par0110" class="elsevierStylePara elsevierViewall">Epigenetic differences&#44; especially the level of IL-6 methylation between BD patients and healthy group&#44; can be an initial manifestation suggested an increased risk of BD prevalence with the low methylation level of IL-6 promoter&#46; On the other hand&#44; this difference can be considered as a main manipulation for BD prevention or treatment&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">Scientists from China reported in previous studies that a significantly higher level of IL-6 in cerebrospinal fluid &#40;CSF&#41; had been detected in Chinese patients with active BD with central nervous system &#40;CNS&#41; involvement&#46;<a class="elsevierStyleCrossRef" href="#bib0385"><span class="elsevierStyleSup">37</span></a> Also&#44; in a previous study about the methylation level of the IL-6 promoter in patients with RA in comparison with healthy groups&#44; the results indicated that a single CpG site at -1&#44;181 was considerably less methylated in subjects with rheumatoid arthritis &#40;RA&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">35</span></a> Some pioneering studies demonstrated that dysregulation of immune system is related to aging&#46; Furthermore&#44; these results revealed that the level of IL-6 expression was intensified with age in animals model such as mice&#46;<a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">38</span></a> It has also been shown that the level of IL-6 are much higher in serum&#44; synovial fluid and synovial tissue in patients with severe RA compared with subjects without inflammatory arthritis which indicates that it is related to the activity of disease&#46;<a class="elsevierStyleCrossRef" href="#bib0395"><span class="elsevierStyleSup">39</span></a> Some contradictory results reported in previous studies&#46; A decrease or no effect of age on IL-6 production had been shown already&#46;<a class="elsevierStyleCrossRef" href="#bib0400"><span class="elsevierStyleSup">40</span></a> According to the results of this clinical study&#44; significant difference could not be seen between patients when dichotomized by age&#46; These diverse results may be caused by the differences in experimental conditions and the health status of subjects in various investigations&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">These results recommend that the level of methylation in promoter region of gene may be a key mechanism for regulation of IL-6 gene expression in BD and IL-6 CpG island hypomethylation might be involved in the progression of BD&#46; Besides&#44; according to the results&#44; molecular methods such as the analysis of DNA methylation could recognize in early detection by changes in the genotype and genome sequencing&#46; This may be used for early diagnosis and initiation of rapid therapies&#46; Therefore&#44; IL-6 can be used as a molecular marker for the diagnosis of Behcet&#39;s patients&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Conclusion</span><p id="par0125" class="elsevierStylePara elsevierViewall">Regarding the results of expression and methylation of IL-6 in this study&#44; it may be considered that methylation may be as one of the regulatory mechanisms involved in regulating gene expression&#46; Generally&#44; epigenetic alteration such as hypermethylation of IL-6 gene may be a potent therapeutic approach in controlling BD&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Conflict of interest</span><p id="par0130" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflicts of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:11 [
        0 => array:3 [
          "identificador" => "xres1348057"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Discussion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1240304"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1348056"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Antecedentes"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Discusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1240303"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Methods and materials"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Patients and healthy controls study group"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "DNA&#44; RNA isolation and RT-PCR method"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Primer design"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Real-time PCR"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Methylated DNA immunoprecipitation assessment"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0045"
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Subject characteristics"
            ]
            1 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Real-time quantitative PCR for IL-6 gene"
            ]
            2 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Methylation status and mRNA expression"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0065"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Conclusion"
        ]
        9 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Conflict of interest"
        ]
        10 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2017-12-11"
    "fechaAceptado" => "2018-06-22"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1240304"
          "palabras" => array:4 [
            0 => "Beh&#231;et&#39;s disease"
            1 => "IL-6"
            2 => "MeDIP-qPCR"
            3 => "Methylation"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1240303"
          "palabras" => array:4 [
            0 => "S&#237;ndrome de Beh&#231;et"
            1 => "IL-6"
            2 => "MeDIP-qPCR"
            3 => "Metilaci&#243;n"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">IL-6 mRNA expression is significantly high in many autoimmune diseases such as Beh&#231;et&#39;s disease&#59; this is often related with more aggressive phenotypes&#46; Nevertheless&#44; the essential molecular process for its high expression has not been completely realized&#46; The aim of this study was undertaken to estimate the gene copy number variation and promoter methylation to IL-6&#39;s high expression&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">This study was performed on 51 patients and 61 healthy controls&#46; Initially&#44; DNA and RNA were extracted from all specimens&#46; Promoter methylation levels of IL-6 were evaluated by MeDIP-qPCR technique&#46; Also&#44; IL-6 gene expression was measured by Real-time PCR&#46; After that&#44; we evaluated the relationship between gene expression and methylation&#44; as well as their relationship with clinical specification&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">As we expected&#44; the expression level of IL-6 gene increased significantly in the patient group compared to the healthy subjects&#46; Also&#44; the relative promoter methylation level of the IL-6 mRNA was significantly lower in patient group compared to healthy group &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#41;&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Discussion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">We disclosed that the promoter hypomethylation may be considered as one of the main defects for IL-6 mRNA high expression in patients with Beh&#231;et&#39;s disease&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Discussion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Antecedentes</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">La expresi&#243;n de ARNm de IL-6 es significativamente elevada en muchas enfermedades autoinmunes&#44; tales como el s&#237;ndrome de Beh&#231;et&#44; y ello se relaciona a menudo con fenotipos m&#225;s agresivos&#46; Sin embargo&#44; no se ha comprendido plenamente el proceso molecular esencial para esta expresi&#243;n elevada&#46; El objetivo de este estudio fue la estimaci&#243;n de la variaci&#243;n del n&#250;mero de copias del gen&#44; y la metilaci&#243;n del promotor de la expresi&#243;n elevada de IL-6&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">M&#233;todos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Este estudio se realiz&#243; en 51 pacientes y 61 controles sanos&#46; Al inicio&#44; se extrajo ADN y ARN de todas las muestras&#46; Se evaluaron los niveles de metilaci&#243;n del promotor de IL-6 mediante la t&#233;cnica MeDIP-qPCR&#46; Tambi&#233;n se midi&#243; la expresi&#243;n del gen IL-6 mediante PCR a tiempo real&#46; Tras ello&#44; evaluamos la relaci&#243;n entre la expresi&#243;n del gen y la metilaci&#243;n&#44; as&#237; como su relaci&#243;n con la especificaci&#243;n cl&#237;nica&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Seg&#250;n lo previsto&#44; el nivel de expresi&#243;n del gen IL-6 se increment&#243; significativamente en el grupo de pacientes&#44; con respecto a los sujetos sanos&#46; Tambi&#233;n encontramos que el nivel relativo de metilaci&#243;n del promotor de ARNm de IL-6 fue considerablemente menor en el grupo de pacientes&#44; con respecto al grupo sano &#40;p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;001&#41;&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Discusi&#243;n</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Concluimos que la hipometilaci&#243;n del promotor puede considerarse uno de los defectos principales de la expresi&#243;n elevada de ARNm de IL-6&#44; en los pacientes con s&#237;ndrome de Beh&#231;et&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Antecedentes"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Discusi&#243;n"
          ]
        ]
      ]
    ]
    "multimedia" => array:7 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 781
            "Ancho" => 2500
            "Tamanyo" => 135146
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">IL-6 promoter methylation&#46; CpG site and island around transcription start site &#40;TSS&#41; were predicted by EPD&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 960
            "Ancho" => 1500
            "Tamanyo" => 48184
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">DNA shearing in gel electrophoresis&#46; Lane &#40;1&#41; 100<span class="elsevierStyleHsp" style=""></span>bp ladder&#44; the extracted DNA is sonicated&#44; load in lanes &#40;3&#8211;8&#41; and Lane &#40;2&#41;&#58; missed&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1072
            "Ancho" => 1529
            "Tamanyo" => 43154
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Change fold of IL-6 expression&#46; Regarding the average changes in the expression of the IL-6 gene in the patients and the healthy groups&#44; the amount of it is comparable to that of the healthy group in the patient group&#44; which indicates that IL-6 gene expression was increased among the patients in the patient group&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1083
            "Ancho" => 1530
            "Tamanyo" => 45647
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Change fold of IL-6 methylation&#46; As shown in the chart&#44; the level of interleukin-6 methylation in the patient group is significantly lower than the healthy group&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence of primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Product size&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Tm&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">IL-6 for gene expression&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCAGAAAACAACCTGAACCGCTTGTTCCTCACTACTCTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">164&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">55&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#946;-Actin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGTGAAGGTGACAGCAGTTGGGGTGGCTTTTAGGAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">154&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">55&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">IL-6 for MeDIP&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCAGGAGAAGATTCCAAAGATGTACGTCGAGGATGTACCGAATTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">94&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">54&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2313768.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">PCR primers and product size&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">As shown in the table&#44; items that have a statistically significant difference are shown as bold&#46; IL-6&#58; interleukin-6&#44; SD&#58; standard deviation&#44; HLA&#58; Human leukocyte antigen&#44; BD&#58; Beh&#231;et&#39;s disease&#44; EN&#58; Erythema Nodosum&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Characteristics and clinical features expression&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Frequency&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Change fold of IL-6 expression&#40;mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Methylation level of IL-6 expression&#40;mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Age</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>&#60;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31 &#40;63&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;13</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;09&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;76</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>&#8805;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;28&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;1<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;71<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Gender</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;29&#41; 61&#46;7&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;2<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;41</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;75<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;18</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;18&#41; 38&#46;3&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;05<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;72<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">HLA-B5-</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17 &#40;33&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;93<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;36</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;31</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;21&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;35<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;86&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;65<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;09&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">HLA-B51</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;15&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;8<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;9</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;5</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;13&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;65<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">HLA-B27</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;34<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;46&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;17</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;88</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">23 &#40;44&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;88<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Oral aphtha</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">45 &#40;96&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;6<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;35</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;5</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;6<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;87&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;74<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;04&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Genital ulcer</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24 &#40;51&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;78</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;68<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;18</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">23 &#40;49&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;66<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;71<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Arthritis</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;19&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;97</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle"><span class="elsevierStyleBold">0&#46;04</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">38 &#40;81&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;74<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Sever B&#46;D&#46;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30 &#40;64&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;41</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;41</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17 &#40;36&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;91<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;71<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Severe eye involvement</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;22&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;9</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;64</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">36 &#40;78&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">EN</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;16&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;62</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;94</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">38 &#40;84&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;8<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Phlebitis</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;11&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;97&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle"><span class="elsevierStyleBold">0&#46;04</span></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;74<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;29</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">41 &#40;89&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;6<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Ocular</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>No eye involvement&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11 &#40;23&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="3" align="char" valign="middle">0&#46;44</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;75<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="3" align="char" valign="middle">0&#46;26</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>One eye activity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;33&#37;&#41;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;1<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;67<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Bilateral activity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21 &#40;44&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;4<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Cataract</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;19&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;1<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;28</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;84</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">36 &#40;74&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;6<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="6" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Vision loss</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>One eye&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;13&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;69<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;84</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;67<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="char" valign="middle">0&#46;45</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>No eye&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">38 &#40;77&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;78<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;34&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;7<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2313767.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Clinical profile of patients with IL-6 gene expression and its methylation&#46;</p>"
        ]
      ]
      6 => array:5 [
        "identificador" => "eq0005"
        "tipo" => "MULTIMEDIAFORMULA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Formula" => array:5 [
          "Matematica" => "FE&#37;&#61;2&#40;IgG CT&#8722;Sample CT&#41;&#215;100&#37;"
          "Fichero" => "STRIPIN_si1.jpeg"
          "Tamanyo" => 1600
          "Alto" => 14
          "Ancho" => 203
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:40 [
            0 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "S&#46; Hirohata"
                            1 => "H&#46; Kikuchi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Arthritis Res Ther"
                        "fecha" => "2003"
                        "volumen" => "5"
                        "paginaInicial" => "139"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epidemiology of Beh&#231;et&#39;s syndrome and regional differences in disease expression&#46; Beh&#231;et&#39;s syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "S&#46; Yurdakul"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:4 [
                        "fecha" => "2010"
                        "paginaInicial" => "35"
                        "paginaFinal" => "52"
                        "editorial" => "Springer"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of a susceptibility locus in STAT4 for Beh&#231;et&#39;s disease in Han Chinese in a genome-wide association study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Hou"
                            1 => "Z&#46; Yang"
                            2 => "L&#46; Du"
                            3 => "Z&#46; Jiang"
                            4 => "Q&#46; Shu"
                            5 => "Y&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Arthritis Rheumatol"
                        "fecha" => "2012"
                        "volumen" => "64"
                        "paginaInicial" => "4104"
                        "paginaFinal" => "4113"
                        "itemHostRev" => array:3 [
                          "pii" => "S0378512216304029"
                          "estado" => "S300"
                          "issn" => "03785122"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Vitamin D receptor gene polymorphisms in Iranian Azary patients with Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Kolahi"
                            1 => "A&#46; Khabbazi"
                            2 => "H&#46; Khodadadi"
                            3 => "M&#46; Estiar"
                            4 => "M&#46; Hajialiloo"
                            5 => "L&#46; Emrahi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/03009742.2014.945477"
                      "Revista" => array:6 [
                        "tituloSerie" => "Scand J Rheumatol"
                        "fecha" => "2015"
                        "volumen" => "44"
                        "paginaInicial" => "163"
                        "paginaFinal" => "167"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25421258"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Upregulated IL-23 and IL-17 in Beh&#231;et patients with active uveitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46; Chi"
                            1 => "X&#46; Zhu"
                            2 => "P&#46; Yang"
                            3 => "X&#46; Liu"
                            4 => "X&#46; Lin"
                            5 => "H&#46; Zhou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Investig Ophthalmol Vis Sci"
                        "fecha" => "2008"
                        "volumen" => "49"
                        "paginaInicial" => "3058"
                        "paginaFinal" => "3064"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genome-wide association studies identify IL23R-IL12RB2 and IL10 as Beh&#231;et&#39;s disease susceptibility loci"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46; Mizuki"
                            1 => "A&#46; Meguro"
                            2 => "M&#46; Ota"
                            3 => "S&#46; Ohno"
                            4 => "T&#46; Shiota"
                            5 => "T&#46; Kawagoe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Nat Genet"
                        "fecha" => "2010"
                        "volumen" => "42"
                        "paginaInicial" => "703"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A single nucleotide polymorphism in the FOXP3 gene associated with Behcet&#39;s disease in an Iranian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Hosseini"
                            1 => "D&#46; Shanehbandi"
                            2 => "M&#46;A&#46; Estiar"
                            3 => "S&#46; Gholizadeh"
                            4 => "A&#46; Khabbazi"
                            5 => "H&#46; Khodadadi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.7754/clin.lab.2015.150433"
                      "Revista" => array:7 [
                        "tituloSerie" => "Clin Lab"
                        "fecha" => "2015"
                        "volumen" => "61"
                        "paginaInicial" => "1897"
                        "paginaFinal" => "1903"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26882813"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0025619617308339"
                          "estado" => "S300"
                          "issn" => "00256196"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of interleukin-2&#44; interleukin-4 and transforming growth factor-beta gene polymorphisms with Behcet&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Shahram"
                            1 => "E&#46; Nikoopour"
                            2 => "N&#46; Rezaei"
                            3 => "K&#46; Saeedfar"
                            4 => "N&#46; Ziaei"
                            5 => "F&#46; Davatchi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Clin Exp Rheumatol"
                        "fecha" => "2011"
                        "volumen" => "29"
                        "numero" => "Suppl&#46; 67"
                        "paginaInicial" => "S28"
                        "paginaFinal" => "S31"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21640045"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Decreased interleukin 27 expression is associated with active uveitis in Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "C&#46; Wang"
                            1 => "Y&#46; Tian"
                            2 => "Z&#46; Ye"
                            3 => "A&#46; Kijlstra"
                            4 => "Y&#46; Zhou"
                            5 => "P&#46; Yang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/ar4570"
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Res Ther"
                        "fecha" => "2014"
                        "volumen" => "16"
                        "paginaInicial" => "R117"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24887071"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serum levels of TNF-&#945;&#44; sIL-2R&#44; IL-6&#44; and IL-8 are increased and associated with elevated lipid peroxidation in patients with Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "C&#46; Evereklioglu"
                            1 => "H&#46; Er"
                            2 => "Y&#46; T&#252;rk&#246;z"
                            3 => "M&#46; &#199;ekmen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Mediat Inflamm"
                        "fecha" => "2002"
                        "volumen" => "11"
                        "paginaInicial" => "87"
                        "paginaFinal" => "93"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Principles of interleukin &#40;IL&#41;-6-type cytokine signalling and its regulation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "P&#46;C&#46; Heinrich"
                            1 => "I&#46; Behrmann"
                            2 => "H&#46; Serge"
                            3 => "H&#46;M&#46; Hermanns"
                            4 => "G&#46; M&#252;ller-Newen"
                            5 => "F&#46; Schaper"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1042/BJ20030407"
                      "Revista" => array:7 [
                        "tituloSerie" => "Biochem J"
                        "fecha" => "2003"
                        "volumen" => "374"
                        "paginaInicial" => "1"
                        "paginaFinal" => "20"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12773095"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0167527315300796"
                          "estado" => "S300"
                          "issn" => "01675273"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cytokines in Behcet&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "N&#46; Sayinalp"
                            1 => "O&#46; Ozcebe"
                            2 => "O&#46; Ozdemir"
                            3 => "I&#46; Haznedaro&#287;lu"
                            4 => "S&#46; D&#252;ndar"
                            5 => "S&#46; Kirazli"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Rheumatol"
                        "fecha" => "1996"
                        "volumen" => "23"
                        "paginaInicial" => "321"
                        "paginaFinal" => "322"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8882039"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin-6-type cytokine signalling through the gp130&#47;Jak&#47;STAT pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "P&#46;C&#46; Heinrich"
                            1 => "I&#46; Behrmann"
                            2 => "G&#46; M&#252;ller-Newen"
                            3 => "F&#46; Schaper"
                            4 => "L&#46; Graeve"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Biochem J"
                        "fecha" => "1998"
                        "volumen" => "334"
                        "paginaInicial" => "297"
                        "paginaFinal" => "314"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epigenetic modifications of interleukin-6 in synovial fibroblasts from osteoarthritis patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Yang"
                            1 => "S&#46; Zhou"
                            2 => "C&#46; Wang"
                            3 => "Y&#46; Huang"
                            4 => "H&#46; Li"
                            5 => "Y&#46; Wang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/srep43592"
                      "Revista" => array:5 [
                        "tituloSerie" => "Sci Rep"
                        "fecha" => "2017"
                        "volumen" => "7"
                        "paginaInicial" => "43592"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28262826"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "KLF4 modulates expression of IL-6 in dendritic cells via both promoter activation and epigenetic modification"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46;M&#46; Rosenzweig"
                            1 => "J&#46;D&#46; Glenn"
                            2 => "P&#46;A&#46; Calabresi"
                            3 => "K&#46;A&#46; Whartenby"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2013"
                        "volumen" => "288"
                        "paginaInicial" => "23868"
                        "paginaFinal" => "23874"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epigenetic alterations in chronic disease focusing on Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Alipour"
                            1 => "M&#46; Nouri"
                            2 => "E&#46; Sakhinia"
                            3 => "N&#46; Samadi"
                            4 => "N&#46; Roshanravan"
                            5 => "A&#46; Ghavami"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.biopha.2017.04.106"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biomed Pharmacother"
                        "fecha" => "2017"
                        "volumen" => "91"
                        "paginaInicial" => "526"
                        "paginaFinal" => "533"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28482290"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A gene hypermethylation profile of human cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Esteller"
                            1 => "P&#46;G&#46; Corn"
                            2 => "S&#46;B&#46; Baylin"
                            3 => "J&#46;G&#46; Herman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Res"
                        "fecha" => "2001"
                        "volumen" => "61"
                        "paginaInicial" => "3225"
                        "paginaFinal" => "3229"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11309270"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mechanisms of disease&#58; the developmental origins of disease and the role of the epigenotype"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "S&#46;E&#46; Ozanne"
                            1 => "M&#46; Const&#226;ncia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Rev Endocrinol"
                        "fecha" => "2007"
                        "volumen" => "3"
                        "paginaInicial" => "539"
                        "itemHostRev" => array:3 [
                          "pii" => "S0140673614617748"
                          "estado" => "S300"
                          "issn" => "01406736"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Methylation and demethylation in the regulation of genes&#44; cells&#44; and responses in the immune system"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46;R&#46; Fitzpatrick"
                            1 => "C&#46;B&#46; Wilson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s1521-6616(03)00205-5"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Immunol"
                        "fecha" => "2003"
                        "volumen" => "109"
                        "paginaInicial" => "37"
                        "paginaFinal" => "45"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14585274"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification of a coordinate regulator of interleukins 4&#44; 13&#44; and 5 by cross-species sequence comparisons"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46;G&#46; Loots"
                            1 => "R&#46;M&#46; Locksley"
                            2 => "C&#46;M&#46; Blankespoor"
                            3 => "Z&#46;-E&#46; Wang"
                            4 => "W&#46; Miller"
                            5 => "E&#46;M&#46; Rubin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1126/science.288.5463.136"
                      "Revista" => array:6 [
                        "tituloSerie" => "Science"
                        "fecha" => "2000"
                        "volumen" => "288"
                        "paginaInicial" => "136"
                        "paginaFinal" => "140"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10753117"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "IL-6&#58; a regulator of the transition from neutrophil to monocyte recruitment during inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "G&#46; Kaplanski"
                            1 => "V&#46; Marin"
                            2 => "F&#46; Montero-Julian"
                            3 => "A&#46; Mantovani"
                            4 => "C&#46; Farnarier"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s1471-4906(02)00013-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "Trends Immunol"
                        "fecha" => "2003"
                        "volumen" => "24"
                        "paginaInicial" => "25"
                        "paginaFinal" => "29"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12495721"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin-1&#946; induces synthesis and secretion of interleukin-6 in human chondrocytes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46; Bender"
                            1 => "H&#46;-D&#46; Haubeck"
                            2 => "E&#46; Van de Leur"
                            3 => "G&#46; Dufhues"
                            4 => "X&#46; Schiel"
                            5 => "J&#46; Lauwerijns"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "FEBS Lett"
                        "fecha" => "1990"
                        "volumen" => "263"
                        "paginaInicial" => "321"
                        "paginaFinal" => "324"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases&#44; matrix metalloproteinases&#44; and other destructive and inflammatory responses in osteoarthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46; Bondeson"
                            1 => "S&#46;D&#46; Wainwright"
                            2 => "S&#46; Lauder"
                            3 => "N&#46; Amos"
                            4 => "C&#46;E&#46; Hughes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/ar2099"
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Res Ther"
                        "fecha" => "2006"
                        "volumen" => "8"
                        "paginaInicial" => "R187"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17177994"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interactions between IL17A&#44; IL23R&#44; and STAT4 polymorphisms confer susceptibility to intestinal Behcet&#39;s disease in Korean population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;S&#46; Kim"
                            1 => "S&#46;W&#46; Kim"
                            2 => "C&#46;M&#46; Moon"
                            3 => "J&#46;J&#46; Park"
                            4 => "T&#46;I&#46; Kim"
                            5 => "W&#46;H&#46; Kim"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.lfs.2012.03.017"
                      "Revista" => array:7 [
                        "tituloSerie" => "Life Sci"
                        "fecha" => "2012"
                        "volumen" => "90"
                        "paginaInicial" => "740"
                        "paginaFinal" => "746"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22483685"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0002914916305616"
                          "estado" => "S300"
                          "issn" => "00029149"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "IL-6 in autoimmune disease and chronic inflammatory proliferative disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "K&#46; Ishihara"
                            1 => "T&#46; Hirano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s1359-6101(02)00027-8"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cytokine Growth Factor Rev"
                        "fecha" => "2002"
                        "volumen" => "13"
                        "paginaInicial" => "357"
                        "paginaFinal" => "368"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12220549"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "IL-6 is an antiinflammatory cytokine required for controlling local or systemic acute inflammatory responses"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Z&#46; Xing"
                            1 => "J&#46; Gauldie"
                            2 => "G&#46; Cox"
                            3 => "H&#46; Baumann"
                            4 => "M&#46; Jordana"
                            5 => "X&#46;-F&#46; Lei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI1368"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Investig"
                        "fecha" => "1998"
                        "volumen" => "101"
                        "paginaInicial" => "311"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9435302"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin 1 receptor antagonist &#40;IL-1Ra&#41; is an acute-phase protein"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "C&#46; Gabay"
                            1 => "M&#46;F&#46; Smith"
                            2 => "D&#46; Eidlen"
                            3 => "W&#46;P&#46; Arend"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI119488"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Investig"
                        "fecha" => "1997"
                        "volumen" => "99"
                        "paginaInicial" => "2930"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9185517"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Validation of the International Study Group criteria for Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46; O&#8217;Neill"
                            1 => "A&#46; Rigby"
                            2 => "A&#46; Silman"
                            3 => "C&#46; Barnes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rheumatology"
                        "fecha" => "1994"
                        "volumen" => "33"
                        "paginaInicial" => "115"
                        "paginaFinal" => "117"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Rapid genomic DNA extraction &#40;RGDE&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S&#46;M&#46; Ali"
                            1 => "S&#46; Mahnaz"
                            2 => "T&#46; Mahmood"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Forensic Sci Int&#58; Genet Suppl Ser"
                        "fecha" => "2008"
                        "volumen" => "1"
                        "paginaInicial" => "63"
                        "paginaFinal" => "65"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cytokines and Behcet&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Z&#46; Zhou"
                            1 => "S&#46; Chen"
                            2 => "N&#46; Shen"
                            3 => "Y&#46; Lu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.autrev.2011.12.005"
                      "Revista" => array:6 [
                        "tituloSerie" => "Autoimmun Rev"
                        "fecha" => "2012"
                        "volumen" => "11"
                        "paginaInicial" => "699"
                        "paginaFinal" => "704"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22197901"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interplay between IFN-&#947; and IL-6 signaling governs neutrophil trafficking and apoptosis during acute inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46;M&#46; McLoughlin"
                            1 => "J&#46; Witowski"
                            2 => "R&#46;L&#46; Robson"
                            3 => "T&#46;S&#46; Wilkinson"
                            4 => "S&#46;M&#46; Hurst"
                            5 => "A&#46;S&#46; Williams"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI17129"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Investig"
                        "fecha" => "2003"
                        "volumen" => "112"
                        "paginaInicial" => "598"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12925700"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1525861013003034"
                          "estado" => "S300"
                          "issn" => "15258610"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Roles of STAT3 in mediating the cell growth&#44; differentiation and survival signals relayed through the IL-6 family of cytokine receptors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "T&#46; Hirano"
                            1 => "K&#46; Ishihara"
                            2 => "M&#46; Hibi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.onc.1203551"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncogene"
                        "fecha" => "2000"
                        "volumen" => "19"
                        "paginaInicial" => "2548"
                        "paginaFinal" => "2556"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10851053"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The effect of novel polymorphisms in the interleukin-6 &#40;IL-6&#41; gene on IL-6 transcription and plasma IL-6 levels&#44; and an association with systemic-onset juvenile chronic arthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Fishman"
                            1 => "G&#46; Faulds"
                            2 => "R&#46; Jeffery"
                            3 => "V&#46; Mohamed-Ali"
                            4 => "J&#46;S&#46; Yudkin"
                            5 => "S&#46; Humphries"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI2629"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Investig"
                        "fecha" => "1998"
                        "volumen" => "102"
                        "paginaInicial" => "1369"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9769329"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Novel IL-6 haplotypes and disease association"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Fife"
                            1 => "E&#46; Ogilvie"
                            2 => "D&#46; Kelberman"
                            3 => "J&#46; Samuel"
                            4 => "A&#46; Gutierrez"
                            5 => "S&#46; Humphries"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.gene.6364186"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genes Immunity"
                        "fecha" => "2005"
                        "volumen" => "6"
                        "paginaInicial" => "367"
                        "paginaFinal" => "370"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15815691"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Methylation status of a single CpG site in the IL6 promoter is related to IL6 messenger RNA levels and rheumatoid arthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "C&#46;J&#46; Nile"
                            1 => "R&#46;C&#46; Read"
                            2 => "M&#46; Akil"
                            3 => "G&#46;W&#46; Duff"
                            4 => "A&#46;G&#46; Wilson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Rheumatol"
                        "fecha" => "2008"
                        "volumen" => "58"
                        "paginaInicial" => "2686"
                        "paginaFinal" => "2693"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin-6 &#40;IL-6&#41; in patients with Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Yamakawa"
                            1 => "Y&#46; Sugita"
                            2 => "T&#46; Nagatani"
                            3 => "S&#46; Takahashi"
                            4 => "T&#46; Yamakawa"
                            5 => "S&#46;-i&#46; Tanaka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/0923-1811(95)00439-4"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Dermatol Sci"
                        "fecha" => "1996"
                        "volumen" => "11"
                        "paginaInicial" => "189"
                        "paginaFinal" => "195"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8785169"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Anticardiolipin antibodies and interleukin-6 in cerebrospinal fluid and blood of Chinese patients with neuro-Beh&#231;et&#39;s syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "C&#46; Wang"
                            1 => "C&#46; Chuang"
                            2 => "C&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Exp Rheumatol"
                        "fecha" => "1991"
                        "volumen" => "10"
                        "paginaInicial" => "599"
                        "paginaFinal" => "602"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1483312"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Age-associated increase in interleukin 6 in MRL&#47;lpr mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Tang"
                            1 => "T&#46; Matsuda"
                            2 => "S&#46; Akira"
                            3 => "N&#46; Nagata"
                            4 => "S&#46; Ikehara"
                            5 => "T&#46; Hirano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/intimm/3.3.273"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int Immunol"
                        "fecha" => "1991"
                        "volumen" => "3"
                        "paginaInicial" => "273"
                        "paginaFinal" => "278"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2049341"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0395"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "In situ hybridization of IL-6 in rheumatoid arthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "N&#46; Wood"
                            1 => "J&#46; Symons"
                            2 => "E&#46; Dickens"
                            3 => "G&#46; Duff"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2249.1992.tb02972.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Exp Immunol"
                        "fecha" => "1992"
                        "volumen" => "87"
                        "paginaInicial" => "183"
                        "paginaFinal" => "189"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1531188"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0400"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interleukin-6 production does not increase with age"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46;A&#46; Beharka"
                            1 => "M&#46; Meydani"
                            2 => "D&#46; Wu"
                            3 => "L&#46;S&#46; Leka"
                            4 => "A&#46; Meydani"
                            5 => "S&#46;N&#46; Meydani"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Gerontol Ser A&#58; Biol Sci Med Sci"
                        "fecha" => "2001"
                        "volumen" => "56"
                        "paginaInicial" => "B81"
                        "paginaFinal" => "B88"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/1699258X/0000001600000003/v1_202006131050/S1699258X18301244/v1_202006131050/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "17499"
    "tipo" => "SECCION"
    "es" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "es"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/1699258X/0000001600000003/v1_202006131050/S1699258X18301244/v1_202006131050/en/main.pdf?idApp=UINPBA00004M&text.app=https://reumatologiaclinica.org/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X18301244?idApp=UINPBA00004M"
]

Información del artículo

ISSN: 1699258X
Idioma original: Inglés

DOI:10.1016/j.reuma.2018.06.006

Datos actualizados diariamente

año/Mes	Html	Pdf	Total

2024 Noviembre	14	10	24
2024 Octubre	119	39	158
2024 Septiembre	93	27	120
2024 Agosto	79	38	117
2024 Julio	76	39	115
2024 Junio	85	40	125
2024 Mayo	89	35	124
2024 Abril	88	36	124
2024 Marzo	83	31	114
2024 Febrero	66	23	89
2024 Enero	66	18	84
2023 Diciembre	82	34	116
2023 Noviembre	85	42	127
2023 Octubre	99	31	130
2023 Septiembre	215	45	260
2023 Agosto	135	18	153
2023 Julio	53	28	81
2023 Junio	43	28	71
2023 Mayo	47	32	79
2023 Abril	43	8	51
2023 Marzo	72	28	100
2023 Febrero	48	34	82
2023 Enero	36	13	49
2022 Diciembre	104	36	140
2022 Noviembre	98	42	140
2022 Octubre	133	36	169
2022 Septiembre	91	28	119
2022 Agosto	73	57	130
2022 Julio	79	39	118
2022 Junio	45	34	79
2022 Mayo	69	41	110
2022 Abril	69	45	114
2022 Marzo	75	55	130
2022 Febrero	66	37	103
2022 Enero	71	37	108
2021 Diciembre	62	49	111
2021 Noviembre	56	45	101
2021 Octubre	103	55	158
2021 Septiembre	69	46	115
2021 Agosto	62	54	116
2021 Julio	51	37	88
2021 Junio	83	57	140
2021 Mayo	93	57	150
2021 Abril	261	83	344
2021 Marzo	116	43	159
2021 Febrero	59	48	107
2021 Enero	62	31	93
2020 Diciembre	62	25	87
2020 Noviembre	40	28	68
2020 Octubre	12	4	16
2020 Septiembre	1	2	3
2020 Junio	2	6	8
2019 Mayo	28	47	75
2019 Abril	32	33	65
2019 Marzo	20	27	47
2019 Febrero	8	10	18
2019 Enero	1	3	4

Mostrar todo

Indexada en:

Síguenos:

Suscribirse:

Estadísticas

Indexada en:

Síguenos:

Suscribirse:

Estadísticas

Suscríbase a la newsletter