array:23 [
  "pii" => "S1699258X23000384"
  "issn" => "1699258X"
  "doi" => "10.1016/j.reuma.2022.12.008"
  "estado" => "S300"
  "fechaPublicacion" => "2023-08-01"
  "aid" => "1672"
  "copyrightAnyo" => "2023"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Reumatol Clin. 2023;19:358-62"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "en" => array:18 [
      "pii" => "S2173574323000758"
      "issn" => "21735743"
      "doi" => "10.1016/j.reumae.2022.12.006"
      "estado" => "S300"
      "fechaPublicacion" => "2023-08-01"
      "aid" => "1672"
      "documento" => "article"
      "crossmark" => 1
      "subdocumento" => "fla"
      "cita" => "Reumatol Clin. 2023;19:358-62"
      "abierto" => array:3 [
        "ES" => false
        "ES2" => false
        "LATM" => false
      ]
      "gratuito" => false
      "lecturas" => array:1 [
        "total" => 0
      ]
      "en" => array:13 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
        "titulo" => "Evaluation of epigenetic-related gene expression &#40;DNMT&#44; HDAC1&#41; in Iranian patients with systemic lupus erythematosus"
        "tienePdf" => "en"
        "tieneTextoCompleto" => "en"
        "tieneResumen" => array:2 [
          0 => "en"
          1 => "es"
        ]
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "358"
            "paginaFinal" => "362"
          ]
        ]
        "titulosAlternativos" => array:1 [
          "es" => array:1 [
            "titulo" => "Evaluaci&#243;n de la expresi&#243;n de los genes relacionados con la epigen&#233;tica &#40;DNMT&#44; HDAC1&#41; en pacientes iran&#237;es con lupus eritematoso sist&#233;mico"
          ]
        ]
        "contieneResumen" => array:2 [
          "en" => true
          "es" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "en" => true
        ]
        "contienePdf" => array:1 [
          "en" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0005"
            "etiqueta" => "Fig&#46; 1"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr1.jpeg"
                "Alto" => 964
                "Ancho" => 1591
                "Tamanyo" => 160069
              ]
            ]
            "descripcion" => array:1 [
              "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">The mean rank of HDAC1 and DNMT genes in systemic lupus erythematosus &#40;SLE&#41; and control groups&#46; There is no significant difference between groups&#46; Results are obtained from three independent experiments and data are presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; The significance level was <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#706;<span class="elsevierStyleHsp" style=""></span>0&#46;05 &#40;HDAC1&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;94&#41;&#44; &#40;DNMT&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;21&#41;&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Mitra Abbasifard, Fahimeh Mohammadiranjbar, Maryam Mohammad-Sadeghipour, Mehdi Mahmoodi, Gholamhossein Hassanshahi, Jennifer Swann, Sadegh Zarei, Reza Hosseiniara, Mohammad Reza Hajizadeh"
            "autores" => array:9 [
              0 => array:2 [
                "nombre" => "Mitra"
                "apellidos" => "Abbasifard"
              ]
              1 => array:2 [
                "nombre" => "Fahimeh"
                "apellidos" => "Mohammadiranjbar"
              ]
              2 => array:2 [
                "nombre" => "Maryam"
                "apellidos" => "Mohammad-Sadeghipour"
              ]
              3 => array:2 [
                "nombre" => "Mehdi"
                "apellidos" => "Mahmoodi"
              ]
              4 => array:2 [
                "nombre" => "Gholamhossein"
                "apellidos" => "Hassanshahi"
              ]
              5 => array:2 [
                "nombre" => "Jennifer"
                "apellidos" => "Swann"
              ]
              6 => array:2 [
                "nombre" => "Sadegh"
                "apellidos" => "Zarei"
              ]
              7 => array:2 [
                "nombre" => "Reza"
                "apellidos" => "Hosseiniara"
              ]
              8 => array:2 [
                "nombre" => "Mohammad Reza"
                "apellidos" => "Hajizadeh"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "en"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S1699258X23000384"
          "doi" => "10.1016/j.reuma.2022.12.008"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => true
            "ES2" => true
            "LATM" => true
          ]
          "gratuito" => true
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X23000384?idApp=UINPBA00004M"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574323000758?idApp=UINPBA00004M"
      "url" => "/21735743/0000001900000007/v1_202309042019/S2173574323000758/v1_202309042019/en/main.assets"
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1699258X22002273"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2022.10.001"
    "estado" => "S300"
    "fechaPublicacion" => "2023-08-01"
    "aid" => "1650"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46; and Sociedad Espa&#241;ola de Reumatolog&#237;a y Colegio Mexicano de Reumatolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Reumatol Clin. 2023;19:363-73"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Relationship between epicardial adipose tissue&#44; systemic inflammatory diseases&#44; and subclinical atheromatosis&#58; A systematic review"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "363"
          "paginaFinal" => "373"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Relaci&#243;n entre tejido adiposo epic&#225;rdico&#44; enfermedades inflamatorias sist&#233;micas y ateromatosis subcl&#237;nica&#58; una revisi&#243;n sistem&#225;tica"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0020"
          "etiqueta" => "Fig&#46; 4"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr4.jpeg"
              "Alto" => 3635
              "Ancho" => 3341
              "Tamanyo" => 765446
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Sensitivity analysis&#46; &#40;A&#41; EAT thickness&#59; &#40;B&#41; EAT volume&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Walter Masson, Augusto Lavalle-Cobo, Leandro Barbagelata, Martin Lobo, Juan Patricio Nogueira"
          "autores" => array:5 [
            0 => array:2 [
              "nombre" => "Walter"
              "apellidos" => "Masson"
            ]
            1 => array:2 [
              "nombre" => "Augusto"
              "apellidos" => "Lavalle-Cobo"
            ]
            2 => array:2 [
              "nombre" => "Leandro"
              "apellidos" => "Barbagelata"
            ]
            3 => array:2 [
              "nombre" => "Martin"
              "apellidos" => "Lobo"
            ]
            4 => array:2 [
              "nombre" => "Juan Patricio"
              "apellidos" => "Nogueira"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2173574323000667"
        "doi" => "10.1016/j.reumae.2022.10.003"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574323000667?idApp=UINPBA00004M"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X22002273?idApp=UINPBA00004M"
    "url" => "/1699258X/0000001900000007/v1_202307241059/S1699258X22002273/v1_202307241059/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S1699258X22002327"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2022.10.003"
    "estado" => "S300"
    "fechaPublicacion" => "2023-08-01"
    "aid" => "1655"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Reumatol Clin. 2023;19:351-7"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Description of a single centre cohort of patients with systemic sclerosis from the University Hospital of Buenos Aires and factors associated with lung function deterioration&#46; A retrospective study"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "351"
          "paginaFinal" => "357"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Descripci&#243;n de una cohorte de pacientes con esclerosis sist&#233;mica del Hospital de la Universidad de Buenos Aires y factores asociados al deterioro de la funci&#243;n pulmonar&#46; Un estudio retrospectivo"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1985
              "Ancho" => 1675
              "Tamanyo" => 136223
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Flow chart of evaluated SSc patients&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Juan I&#46; Enghelmayer, Mar&#237;a Jos&#233; L&#243;pez Meiller, Ail&#237;n Vallejos, Federico Felder, Mar&#237;a Milena Pertuz, Tamara Arias, Cora G&#46; Legarreta, Silvana Acu&#241;a, Sebasti&#225;n Leiva, Vanesa Barrios, Diana Dubinsky"
          "autores" => array:11 [
            0 => array:2 [
              "nombre" => "Juan I&#46;"
              "apellidos" => "Enghelmayer"
            ]
            1 => array:2 [
              "nombre" => "Mar&#237;a Jos&#233;"
              "apellidos" => "L&#243;pez Meiller"
            ]
            2 => array:2 [
              "nombre" => "Ail&#237;n"
              "apellidos" => "Vallejos"
            ]
            3 => array:2 [
              "nombre" => "Federico"
              "apellidos" => "Felder"
            ]
            4 => array:2 [
              "nombre" => "Mar&#237;a Milena"
              "apellidos" => "Pertuz"
            ]
            5 => array:2 [
              "nombre" => "Tamara"
              "apellidos" => "Arias"
            ]
            6 => array:2 [
              "nombre" => "Cora G&#46;"
              "apellidos" => "Legarreta"
            ]
            7 => array:2 [
              "nombre" => "Silvana"
              "apellidos" => "Acu&#241;a"
            ]
            8 => array:2 [
              "nombre" => "Sebasti&#225;n"
              "apellidos" => "Leiva"
            ]
            9 => array:2 [
              "nombre" => "Vanesa"
              "apellidos" => "Barrios"
            ]
            10 => array:2 [
              "nombre" => "Diana"
              "apellidos" => "Dubinsky"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2173574323000680"
        "doi" => "10.1016/j.reumae.2022.10.004"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574323000680?idApp=UINPBA00004M"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X22002327?idApp=UINPBA00004M"
    "url" => "/1699258X/0000001900000007/v1_202307241059/S1699258X22002327/v1_202307241059/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "Evaluation of epigenetic-related gene expression &#40;DNMT&#44; HDAC1&#41; in Iranian patients with systemic lupus erythematosus"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "358"
        "paginaFinal" => "362"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Mitra Abbasifard, Fahimeh Mohammadiranjbar, Maryam Mohammad-Sadeghipour, Mehdi Mahmoodi, Gholamhossein Hassanshahi, Jennifer Swann, Sadegh Zarei, Reza Hosseiniara, Mohammad Reza Hajizadeh"
        "autores" => array:9 [
          0 => array:3 [
            "nombre" => "Mitra"
            "apellidos" => "Abbasifard"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Fahimeh"
            "apellidos" => "Mohammadiranjbar"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Maryam"
            "apellidos" => "Mohammad-Sadeghipour"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Mehdi"
            "apellidos" => "Mahmoodi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Gholamhossein"
            "apellidos" => "Hassanshahi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Jennifer"
            "apellidos" => "Swann"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0030"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Sadegh"
            "apellidos" => "Zarei"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Reza"
            "apellidos" => "Hosseiniara"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">g</span>"
                "identificador" => "aff0035"
              ]
            ]
          ]
          8 => array:4 [
            "nombre" => "Mohammad Reza"
            "apellidos" => "Hajizadeh"
            "email" => array:1 [
              0 => "hajizadehus@yahoo.com"
            ]
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:7 [
          0 => array:3 [
            "entidad" => "Molecular Medicine Research Center&#44; Research Institute of Basic Medical Sciences&#44; Rafsanjan University of Medical Sciences&#44; Rafsanjan&#44; Iran"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Department of Internal Medicine&#44; Ali-Ibn AbiTalib hospital&#44; School of Medicine&#44; Rafsanjan University of Medical Sciences&#44; Rafsanjan&#44; Iran"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Clinical Biochemistry&#44; Faculty of Medicine&#44; Rafsanjan University of Medical Sciences&#44; Rafsanjan&#44; Iran"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Department of Clinical Biochemistry&#44; Afzalipour School of Medicine&#44; Kerman University of Medical Sciences&#44; Kerman&#44; Iran"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Molecular Medicine Research Centre&#44; Institute of Basics Medical Sciences&#44; Rafsanjan University of Medical Sciences&#44; Rafsanjan&#44; Iran"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
          5 => array:3 [
            "entidad" => "Biological Sciences&#44; Interim Director of Africana Studies&#44; Williams Hall&#44; Lehigh University&#44; Bethlehem&#44; United States"
            "etiqueta" => "f"
            "identificador" => "aff0030"
          ]
          6 => array:3 [
            "entidad" => "Faculty of Medicine and Health Care&#44; Al-Farabi Kazakh National University&#44; Almaty&#44; Kazakhstan"
            "etiqueta" => "g"
            "identificador" => "aff0035"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Evaluaci&#243;n de la expresi&#243;n de los genes relacionados con la epigen&#233;tica &#40;DNMT&#44; HDAC1&#41; en pacientes iran&#237;es con lupus eritematoso sist&#233;mico"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 964
            "Ancho" => 1591
            "Tamanyo" => 160069
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">The mean rank of HDAC1 and DNMT genes in systemic lupus erythematosus &#40;SLE&#41; and control groups&#46; There is no significant difference between groups&#46; Results are obtained from three independent experiments and data are presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; The significance level was <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#706;<span class="elsevierStyleHsp" style=""></span>0&#46;05 &#40;HDAC1&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;94&#41;&#44; &#40;DNMT&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;21&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Systemic lupus erythematosus &#40;SLE&#41; is an autoimmune disease that is associated with vascular and connective tissue inflammation&#46; SLE affects a variety of organs including the joints&#44; skin&#44; kidneys&#44; and heart&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">1</span></a> SLE can also cause significant problems in the nervous system&#46; SLE occurs all over the world&#44; with a prevalence of 20&#8211;150 cases per 100&#44;000 people&#46; In Iran&#44; SLE occurs in about 40 cases per 100&#44;000 people&#46;<a class="elsevierStyleCrossRefs" href="#bib0200"><span class="elsevierStyleSup">2&#44;3</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">SLE may affect active B cells and T cells causing abnormal differentiation&#46; Increased activation of these cells leads to the production of antibodies against nucleic acids&#44; proteins&#44; and ribonucleoproteins&#46; Clinical symptoms vary based on the type of damaged tissue&#46; SLE is also determined by hereditary and environmental factors including ultraviolet radiation and drugs&#46;<a class="elsevierStyleCrossRefs" href="#bib0210"><span class="elsevierStyleSup">4&#44;5</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">SLE causes extensive damage to the connective tissue&#44; blood vessels&#44; and serous membranes&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">6</span></a> The progression of SLE is unpredictable&#44; involves many changes that lead to progressive disability in young patients&#44; and has a variety of harmful effects on physical&#44; psychological&#44; and social health fields&#46;<a class="elsevierStyleCrossRefs" href="#bib0225"><span class="elsevierStyleSup">7&#44;8</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">Epigenetics is the study of the heritable changes in the function and expression of genes&#44; in the absence of changes in the DNA sequence&#46; Epigenetic mechanisms include DNA methylation&#44; histone modification&#44; and alteration in transcription factors<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">9</span></a> that lead to the expression or non-expression of genes&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">10</span></a> Epigenetic changes can be determined by evaluating DNA methyltransferase &#40;DNMT&#41; and histone deacetylase 1 &#40;HDAC1&#41;&#44; enzymes related to DNA methylation and acetylation&#46; The reduction of DNMT1 expression and enhancement of methylation-sensitive autoimmune genes activation in T cells of patients with SLE could be a part of epigenetic changes&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">11</span></a> The relationship between DNMT1 and HDAC1 and SLE and other autoimmune diseases has been reported&#44;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">11</span></a> suggesting the study of epigenetic mechanisms in regulating gene expression and the effect of drugs on these genes&#46; Different environmental pollutions can lead to epigenetic changes&#44;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">12</span></a> and that&#44; in turn&#44; may cause autoimmune diseases such as SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">13</span></a> Rafsanjan city in the southeast of Iran is prone to environmental pollution&#44; including agricultural pesticides and contaminants from Sarcheshmeh copper mine pollutants which may contribute to epigenetic changes&#46; Therefore&#44; the evaluation of related epigenetic genes in patients in Rafsanjan with SLE is warranted&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">In this study&#44; we examined the DNMT and HDAC1 genes expression in Iranian SLE patients referred to the Rafsanjan rheumatology clinic&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Study setting and participants</span><p id="par0030" class="elsevierStylePara elsevierViewall">A matched case&#8211;control study design was used&#46; During three month &#40;1 Oct to 30 Dec 2020&#41;&#44; sixteen Iranian patients with SLE admitted to rheumatology clinic in Rafsanjan city&#44; the southeast of Iran&#44; were included in the case group in a consecutive manner&#46; For the control group&#44; sixteen healthy people from the hospital staff of Rafsanjan city selected by random method&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Inclusion and exclusion criteria for case group</span><p id="par0035" class="elsevierStylePara elsevierViewall">The patients fulfilled the American College of Rheumatology diagnostic criteria for SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">14</span></a> Then 16 patients were appraised with clinical examination &#40;there are no more patients with SLE in Rafsanjan city&#41;&#44; and laboratory tests such as ESR&#44; CRP&#44; RF&#44; anti CCP&#44; ANA&#44; anti DS DNA were performed&#46; A rheumatologist then confirmed the results&#46; The voluntary and informed participation in the case group were considered&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Inclusion and exclusion criteria for control group</span><p id="par0040" class="elsevierStylePara elsevierViewall">Sixteen adult healthy people &#40;18&#8211;65 years old&#41; who had no ACR criteria were recruited from the hospital staff of Rafsanjan&#46; Subjects that had used anti-inflammatory drugs in the last three months or had the main symptoms of SLE in their family were excluded from the control group&#46; The voluntary and informed participation in the control group were considered&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Samples size</span><p id="par0045" class="elsevierStylePara elsevierViewall">According to the inclusion and exclusion criteria&#44; all adult SLE patients &#40;18&#8211;65 years old&#41; in Rafsanjan city during 1 Oct to 30 Dec 2020 were enrolled as the case group&#46; The ratio of control to case was 1&#58;1&#44; and matching age and sex&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Collecting data</span><p id="par0050" class="elsevierStylePara elsevierViewall">Demographic and epidemiologic data including age&#44; sex&#44; academic education &#40;BSc&#44; MSc&#44; Ph&#46;D&#46;&#41;&#44; smoking at least one cigarette a day&#44; body mass index &#40;BMI&#41;&#44; and job status were matched between the two groups&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Experimental procedure</span><p id="par0055" class="elsevierStylePara elsevierViewall">A 10<span class="elsevierStyleHsp" style=""></span>ml blood sample was obtained from each subject in both groups&#46; A sample of the blood &#40;3<span class="elsevierStyleHsp" style=""></span>ml&#41; was reserved for ELISA assay&#44; and an additional sample &#40;7<span class="elsevierStyleHsp" style=""></span>ml&#41; was collected in EDTA tubes for the real-time PCR method&#46; Clotted blood was centrifuged for 3&#8211;5<span class="elsevierStyleHsp" style=""></span>min with 3000<span class="elsevierStyleHsp" style=""></span>rpm to separate the serum&#46; The serum was kept at &#8722;20<span class="elsevierStyleHsp" style=""></span>&#176;C until analyzed for ANA and CCP via ELSA kits &#40;Germany&#44; AESKU&#41; according to the kit protocol&#46;</p><p id="par0060" class="elsevierStylePara elsevierViewall">An RNA extraction kit was applied to extract total RNA from peripheral blood samples&#46; Extracted RNA quality was determined via electrophoresis on the ethidium bromide pretreated agarose gels&#46; Absorption was measured at 260&#47;280<span class="elsevierStyleHsp" style=""></span>nm by a spectrophotometer&#46; cDNA was synthesized using a cDNA synthesis kit &#40;Parstous&#44; Iran&#41; according to the manufacturer&#39;s instructions&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">5<span class="elsevierStyleHsp" style=""></span>&#956;l SYBR of green master mix &#40;Parstous&#44; Iran&#41;&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;l of the generated cDNA&#44; and 0&#46;8<span class="elsevierStyleHsp" style=""></span>&#956;M of forward and reverse appropriate primers &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41; were mixed for real-time quantitative PCR&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0070" class="elsevierStylePara elsevierViewall">The cycling program on a BIO-RAD CFX96 system &#40;Bio-Rad Company&#44; USA&#41; was completed as follows&#58; one cycle of 94<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; 45 cycles of 94<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>s&#44; and 45 cycles for 34<span class="elsevierStyleHsp" style=""></span>s&#46; This cycle was performed in triplicate&#44; and &#946;-actin was evaluated as a housekeeping gene&#46; 2<span class="elsevierStyleSup">&#8722;&#916;&#916;ct</span> formula was applied for the relative amounting of the PCR product&#46; The dissociation stages&#44; melting curves&#44; and quantitative analyses of the data were performed using CFX manager software version 1&#46;1&#46;308&#46;111 &#40;Bio-Rad&#44; USA&#41;&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Statistical analysis</span><p id="par0075" class="elsevierStylePara elsevierViewall">The continuous variables were expressed as the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#44; and the categorical variables were presented as a percentage and frequency&#46; Because the data showed a non-normal distribution&#44; the Mann&#8211;Whitney test was used to compare the parameters between patients and health groups&#46; The relations between parameters were evaluated using the Pearson correlation coefficient&#46; All statistical analyses were performed with SPSS &#40;version 16&#46;0&#44; SPSS Inc&#44; Chicago&#44; IL&#44; USA&#41;&#46; A &#8220;<span class="elsevierStyleItalic">P</span>-value&#8221; less than 0&#46;05 was considered significant&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Ethical considerations</span><p id="par0080" class="elsevierStylePara elsevierViewall">The study was conducted in accordance with the Declaration of Helsinki&#46; Institutional Review Board approval &#40;code&#58; IR&#46;RUMS&#46;REC&#46;1396&#46;119&#41; was obtained &#40;April 2020&#41;&#46; The present study did not interfere with the process of diagnosis and treatment of patients and all participants signed an informed consent form&#46;</p></span></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Results</span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Demographic and epidemiological characteristics</span><p id="par0085" class="elsevierStylePara elsevierViewall">This case-control study included 16 patients with SLE &#40;case group&#41; and 16 healthy people &#40;control group&#41;&#46; Demographic and epidemiological data were matched between two groups &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; and provided in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; Most subjects in case and control groups were women&#44; married and housekeepers&#46; One person in the control group was a tobacco smoker&#46; The mean age was 43&#46;2<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>11&#46;4 years and 38&#46;9<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>12&#46;1 years for case and control groups&#44; respectively &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;31&#41;&#46; 56&#46;2&#37; and 37&#46;5&#37; of the subjects were more than 41 years old in case and control group&#44; respectively&#46; The highest percentage and frequency for BMI in patients was 25&#8211;29&#46;5&#44; with 43&#46;8&#37; that showed most of the patients are overweight&#46; In the control group&#44; healthy BMI &#40;9&#46;5&#8211;24&#46;18&#41; was in first order with 45&#37;&#46; The minority of both groups had academic education &#40;BSc&#44; MSc&#44; PhD&#41;&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Experimental findings</span><p id="par0090" class="elsevierStylePara elsevierViewall">The expression of DNMT and HDAC1 genes were evaluated&#44; via real-time PCR assay&#44; and patients with SLE were compared to healthy group&#46; The mean rank of DNMT gene expression was 17&#46;63 in the SLE group and 17&#46;39 in the control group&#46; Mann&#8211;Whitney statistical test reported that the expression of this gene did not differ significantly between SLE and control groups &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;21&#41;&#46; The mean rank in the expression of the HDAC1 gene was 20&#46;33 and 16&#46;25 in SLE and control groups&#44; respectively&#46; While HDAC1 gene expression was enhanced in the SLE group&#44; this enhancement was not statistically significant &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;94&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Discussion</span><p id="par0095" class="elsevierStylePara elsevierViewall">Comparison of serum levels of the epigenetic genes of 16 patients with SLE and 16 healthy people indicate that the expression of the DNMT gene did not differ between SLE and control groups&#46; While HDAC1 gene expression increased in the SLE group this increase was not significant&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">In contrast with our finding&#44; previous studies have evaluated DNA methylation in T cells from SLE patients and found the mean DNMT gene expression significantly diminished&#46;<a class="elsevierStyleCrossRefs" href="#bib0265"><span class="elsevierStyleSup">15&#44;16</span></a> Pan et al&#46; &#40;2010&#41; also demonstrated that the DNMT gene reduced in patients with SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">17</span></a> Decreasing DNMT gene expression could be the result of inhibition of ERK pathway signaling&#44; which causes overexpression of some genes that improve the SLE disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0280"><span class="elsevierStyleSup">18&#8211;20</span></a> DNMT is reduced in older people and could be a cause of rheumatoid disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0295"><span class="elsevierStyleSup">21&#44;22</span></a></p><p id="par0105" class="elsevierStylePara elsevierViewall">Consistent with our study&#44; Hu et al&#46;&#44; reported that HDAC1 gene expression was not significantly different between patients with SLE and healthy people&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">23</span></a> Nawrocki et al&#46;&#44; found HDAC1-3 mRNA expression significantly enhanced in patients with SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">24</span></a> HDAC has been shown to exacerbate inflammation in vitro&#44; and HDAC inhibitors can help in the treatment of inflammation in the arthritis&#46;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">25</span></a> Lin et al&#46;&#44; indicated that overexpression of HDAC1 might be a reason for the inflammation&#44; and an HDAC inhibitor could reduce inflammation or disease progression&#46;<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">26</span></a> Horiuchi et al&#46;&#44; studied the expression of HDAC in rheumatoid arthritis synovial fibroblasts and reported that HDAC1 enhanced synovial fibroblasts&#46;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">27</span></a> Kawabata et al&#46;&#44; found that HDAC1 increased in synovial tissue and suggested that the overexpression of HDAC1 might contribute to synovial inflammation&#46;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">25</span></a></p><p id="par0110" class="elsevierStylePara elsevierViewall">In this matched case&#8211;control study&#59; most patients were women &#40;93&#46;7&#37;&#41;&#44; were over 41 years old &#40;56&#46;2&#37;&#41; and most patients were overweight &#40;BMI<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>25&#8211;29&#46;9<span class="elsevierStyleHsp" style=""></span>kg&#47;m<span class="elsevierStyleSup">2</span>&#41; &#40;43&#46;8&#37;&#41; and obese &#40;BMI<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>30<span class="elsevierStyleHsp" style=""></span>kg&#47;m<span class="elsevierStyleSup">2</span>&#41; &#40;25&#37;&#41;&#46; The majority of patients in our study were women consistent with reports that SLE is more prevalent among females&#46;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">28</span></a> SLE in women has been associated with a number of reproductive factors including oral contraceptive use&#44; older age at menarche &#40;&#8804;10 years&#41; and the adoption of hormone replacement therapy following menopause&#46;<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">29</span></a> And sex specific changes in aging B cells that precede autoimmune disease induce have also been identified in mice&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">30</span></a></p><p id="par0115" class="elsevierStylePara elsevierViewall">The population in this study was middle-aged and aging has been associated with a decline in immunity<a class="elsevierStyleCrossRef" href="#bib0345"><span class="elsevierStyleSup">31</span></a> that includes changes in autoantibody levels<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">32</span></a> that could be influencing the progression of the disease&#46; Obesity has also been shown to contribute to SLE<a class="elsevierStyleCrossRefs" href="#bib0330"><span class="elsevierStyleSup">28&#44;33</span></a> and rheumatoid arthritis<a class="elsevierStyleCrossRef" href="#bib0360"><span class="elsevierStyleSup">34</span></a> &#8211; another autoimmune disease &#8211; via changes in adipokines&#44; inflammatory cytokines&#44; released from adipose tissue&#46;<a class="elsevierStyleCrossRefs" href="#bib0365"><span class="elsevierStyleSup">35&#44;36</span></a> Adipose tissue also contains aromatase enzymes and enhances to steroid hormone levels by converting androgens to estrogens&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">37</span></a></p><p id="par0120" class="elsevierStylePara elsevierViewall">Although smoking has been shown to be a risk factor for SLE&#44;<a class="elsevierStyleCrossRef" href="#bib0380"><span class="elsevierStyleSup">38</span></a> none of the patients in the present study smoked&#46; Part of this is related to Iranian culture&#44; where smoking is considered to be unflattering to women&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Conclusion</span><p id="par0125" class="elsevierStylePara elsevierViewall">In the present study&#44; although the expression of DNMT was not different between case and control groups&#44; the expression of HDAC1 increased in SLE patients&#46; A larger sample size might support the overexpression of HDAC1 as a diagnostic method for SLE disease as this gene is related to inflammation and rheumatoid disease&#46; Evaluation of other genes that are related to SLE disease is essential and may help an accurate diagnosis of the disease&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">Availability of data and materials</span><p id="par0130" class="elsevierStylePara elsevierViewall">The data used in this study are available from the corresponding author on request&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0160">Ethics approval and consent to participate</span><p id="par0135" class="elsevierStylePara elsevierViewall">The study was conducted in accordance with the Declaration of Helsinki and Institutional Review Board approval has been obtained &#40;IR&#46;RUMS&#46;REC&#46;1396&#46;119&#41;&#46;</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0165">Consent for publication</span><p id="par0140" class="elsevierStylePara elsevierViewall">By submitting this document&#44; the authors declare their consent for the final accepted version of the manuscript to be considered for publication&#46;</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0170">Authors&#8217; contributions</span><p id="par0145" class="elsevierStylePara elsevierViewall">MA and MRH were responsible for the study concept and design&#46; MA&#44; FM&#44; MMS&#44; and GH led data collection&#46; MA&#44; FM&#44; and MRH were responsible for the analysis and interpretation of data&#46; MA and MM wrote the first draft&#46; JS&#44; MMS&#44; GH&#44; and MRH contributed to the writing of the second and third drafts&#46; JS&#44; MRH&#44; and RH provided comments on initial drafts and coordinated the final draft&#46; All authors read and approved the final manuscript&#46; All authors take responsibility for the integrity of the data and the accuracy of the data analysis&#46;</p></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0175">Funding</span><p id="par0150" class="elsevierStylePara elsevierViewall">Thanks to financial support&#44; guidance&#44; and advice from the &#8220;<span class="elsevierStyleGrantSponsor" id="gs1">Rafsanjan University of Medical Sciences</span>&#8221;&#46;</p></span><span id="sec0105" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0180">Conflicts of interest</span><p id="par0155" class="elsevierStylePara elsevierViewall">The authors of this study declare no conflict of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:18 [
        0 => array:3 [
          "identificador" => "xres1937894"
          "titulo" => "Abstract"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Aims"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            4 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1669985"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "xpalclavsec1669987"
          "titulo" => "Abbreviations"
        ]
        3 => array:3 [
          "identificador" => "xres1937893"
          "titulo" => "Resumen"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Antecedentes"
            ]
            1 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Objetivo"
            ]
            2 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "M&#233;todos"
            ]
            3 => array:2 [
              "identificador" => "abst0045"
              "titulo" => "Resultados"
            ]
            4 => array:2 [
              "identificador" => "abst0050"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "xpalclavsec1669986"
          "titulo" => "Palabras clave"
        ]
        5 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        6 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:8 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Study setting and participants"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Inclusion and exclusion criteria for case group"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Inclusion and exclusion criteria for control group"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Samples size"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Collecting data"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Experimental procedure"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Statistical analysis"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Ethical considerations"
            ]
          ]
        ]
        7 => array:3 [
          "identificador" => "sec0055"
          "titulo" => "Results"
          "secciones" => array:2 [
            0 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Demographic and epidemiological characteristics"
            ]
            1 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Experimental findings"
            ]
          ]
        ]
        8 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Discussion"
        ]
        9 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Conclusion"
        ]
        10 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Availability of data and materials"
        ]
        11 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Ethics approval and consent to participate"
        ]
        12 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Consent for publication"
        ]
        13 => array:2 [
          "identificador" => "sec0095"
          "titulo" => "Authors&#8217; contributions"
        ]
        14 => array:2 [
          "identificador" => "sec0100"
          "titulo" => "Funding"
        ]
        15 => array:2 [
          "identificador" => "sec0105"
          "titulo" => "Conflicts of interest"
        ]
        16 => array:2 [
          "identificador" => "xack679034"
          "titulo" => "Acknowledgment"
        ]
        17 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-07-21"
    "fechaAceptado" => "2022-12-29"
    "PalabrasClave" => array:2 [
      "en" => array:2 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1669985"
          "palabras" => array:5 [
            0 => "DNA methyltransferase"
            1 => "Epigenetic"
            2 => "Histone deacetylase 1"
            3 => "Systemic lupus erythematosus"
            4 => "Iran"
          ]
        ]
        1 => array:4 [
          "clase" => "abr"
          "titulo" => "Abbreviations"
          "identificador" => "xpalclavsec1669987"
          "palabras" => array:12 [
            0 => "SLE"
            1 => "DNMT"
            2 => "HDAC1"
            3 => "ESR"
            4 => "CRP"
            5 => "RF"
            6 => "ANTI CCP"
            7 => "ANA"
            8 => "Anti DS DNA"
            9 => "BMI"
            10 => "cDNA"
            11 => "PCR"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1669986"
          "palabras" => array:5 [
            0 => "ADN metiltransferasa"
            1 => "Epig&#233;netica"
            2 => "Histona deacetilasa 1"
            3 => "Lupus eritematoso sist&#233;mico"
            4 => "Ir&#225;n"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Systemic lupus erythematosus &#40;SLE&#41; is an autoimmune disease in which the immune system abnormally reacts against cells and tissues leading to inflammation&#46; Epigenetic alterations&#44; including DNA methylation and histone modification&#44; have critical effects on autoimmune disease and SLE pathogenesis via dysregulation of critical genes&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Aims</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">The purpose of this study was to evaluate the epigenetic-related gene expression of DNA methyltransferase &#40;DNMT&#41; and histone deacetylase 1 &#40;HDAC1&#41; in Iranian patients with SLE&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Methods</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">This matched case&#8211;control study included 16 people with SLE and 16 healthy people who were referred to the Rafsanjani rheumatology clinic&#44; in southeast Iran&#46; The expression of DNMT and HDAC1 genes was measured through a real-time PCR assay of blood samples&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Results</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">DNMT gene expression did not differ significantly between SLE and healthy groups &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;21&#41;&#46; In contrast&#44; HDAC1 gene expression was enhanced in the SLE group&#44; but this enhancement failed to reach statistical significance &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;94&#41;&#46;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Conclusion</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">The results of this study suggest that overexpression of HDAC1 could serve as a diagnostic for SLE disease&#46; Additional studies with larger sample sizes are required to confirm our findings&#46; Evaluation of other genes related to SLE disease is essential and may help to make an accurate diagnosis of the disease&#46;</p></span>"
        "secciones" => array:5 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Aims"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Methods"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Results"
          ]
          4 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Antecedentes</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">El lupus eritematoso sist&#233;mico &#40;LES&#41; es una enfermedad autoinmune&#44; en la cual el sistema inmunitario reacciona de manera anormal frente a las c&#233;lulas y tejidos causantes de la inflamaci&#243;n&#46; Las alteraciones epigen&#233;ticas&#44; incluyendo la metilaci&#243;n del ADN y la modificaci&#243;n de la histona&#44; tienen efectos cr&#237;ticos en la enfermedad autoinmune y la patogenia del LES&#44; a trav&#233;s de la desregulaci&#243;n de los genes cr&#237;ticos&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Objetivo</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">El objetivo de este estudio fue evaluar la expresi&#243;n del gen relacionado con la epigen&#233;tica de ADN metiltransferasa &#40;DNMT&#41; e histona deacetilasa 1 &#40;HDAC1&#41; en los pacientes iran&#237;es afectados de LES&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">M&#233;todos</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Este estudio pareado caso-control incluy&#243; 16 personas con LES y 16 personas sanas&#44; derivadas a la cl&#237;nica de reumatolog&#237;a de Rafsanjan&#44; en el sudeste de Ir&#225;n&#46; La expresi&#243;n de los genes DNMT y HDAC1 se midi&#243; mediante una PCR a tiempo real de muestras de sangre&#46;</p></span> <span id="abst0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Resultados</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">La expresi&#243;n del gen DNMT no difiri&#243; significativamente entre los grupos de pacientes de LES y de controles sanos &#40;p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#44;21&#41;&#46; Por contra&#44; la expresi&#243;n del gen HDAC1 se increment&#243; en el grupo LES&#44; aunque dicho incremento no alcanz&#243; significaci&#243;n estad&#237;stica &#40;p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#44;94&#41;&#46;</p></span> <span id="abst0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Conclusi&#243;n</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Los resultados de este estudio sugieren que la sobreexpresi&#243;n de HDAC1 podr&#237;a servir para diagnosticar el LES&#46; Son necesarios estudios adicionales con muestras de mayor tama&#241;o para confirmar nuestros hallazgos&#46; Es esencial la evaluaci&#243;n de otros genes relacionados con el LES&#44; pudiendo ayudar a realizar un diagn&#243;stico preciso de la enfermedad&#46;</p></span>"
        "secciones" => array:5 [
          0 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Antecedentes"
          ]
          1 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Objetivo"
          ]
          2 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "M&#233;todos"
          ]
          3 => array:2 [
            "identificador" => "abst0045"
            "titulo" => "Resultados"
          ]
          4 => array:2 [
            "identificador" => "abst0050"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "multimedia" => array:3 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 964
            "Ancho" => 1591
            "Tamanyo" => 160069
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">The mean rank of HDAC1 and DNMT genes in systemic lupus erythematosus &#40;SLE&#41; and control groups&#46; There is no significant difference between groups&#46; Results are obtained from three independent experiments and data are presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; The significance level was <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#706;<span class="elsevierStyleHsp" style=""></span>0&#46;05 &#40;HDAC1&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;94&#41;&#44; &#40;DNMT&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;21&#41;&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">DNA methyltransferase 1 &#40;DNMT1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Forward</span>&#58; CCGGCCCCGGTTCTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Reverse</span>&#58; GGACCATGGAGCGCTTGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Histone deacetylase 1 &#40;HDAC1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Forward</span>&#58; CGCCAAGTGTGTGGAATTTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Reverse</span>&#58; GCCTCCCAGCATCAGCATA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#946;-Actin &#40;housekeeping gene&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Forward</span>&#58; GATATCGCTGCGCTCGTCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Reverse</span>&#58; CCCATACCCACCATCACACC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3228017.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">The list of the sequence of primers used for real-time PCR in this study&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Case group<span class="elsevierStyleItalic">N</span> &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Control group<span class="elsevierStyleItalic">N</span> &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">P</span> value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Age &#40;years&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Up to 30&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;18&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>31&#8211;40&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;37&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;43&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>41&#8211;50&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;25&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;31&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>51&#8211;60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;31&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>More than 60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Body mass index &#40;kg&#47;m</span><span class="elsevierStyleSup"><span class="elsevierStyleItalic">2</span></span><span class="elsevierStyleItalic">&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Up to 18&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;31&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>18&#46;5&#8211;24&#46;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;18&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;50&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>25&#8211;29&#46;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;43&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;37&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>30&#8211;34&#46;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;25&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>More than 35&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Gender</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;93&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;87&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;55&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;6&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;12&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Academic education</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;12&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;37&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;87&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;62&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Job status</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Housewife&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;93&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;81&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;67&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Clerk&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;6&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;18&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Smoking &#40;one cigarette a day&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;6&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;31&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;100&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;93&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Marital status</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Married&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;87&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;81&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;63&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Single&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;12&#46;5&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;18&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3228016.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Demographic and epidemiological data in case &#40;16 patients with systemic lupus erythematosus&#59; SLE&#41; and control &#40;16 healthy people&#41; groups&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:38 [
            0 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biologics in the treatment of lupus erythematosus&#58; a critical literature review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46; Samotij"
                            1 => "A&#46; Reich"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1155/2019/8142368"
                      "Revista" => array:5 [
                        "tituloSerie" => "Biomed Res Int"
                        "fecha" => "2019"
                        "volumen" => "2019"
                        "paginaInicial" => "8142368"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31396534"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "WHO-ILAR COPCORD study &#40;stage 1&#44; urban study&#41; in Iran"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Davatchi"
                            1 => "A&#46;-R&#46; Jamshidi"
                            2 => "A&#46;T&#46; Banihashemi"
                            3 => "J&#46; Gholami"
                            4 => "M&#46;H&#46; Forouzanfar"
                            5 => "M&#46; Akhlaghi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Rheumatol"
                        "fecha" => "2008"
                        "volumen" => "35"
                        "paginaInicial" => "1384"
                        "paginaFinal" => "1390"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18464299"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Lupus&#58; mysterious disease holds its secrets tight"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "E&#46; Marshall"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1126/science.296.5568.689"
                      "Revista" => array:6 [
                        "tituloSerie" => "Science"
                        "fecha" => "2002"
                        "volumen" => "296"
                        "paginaInicial" => "689"
                        "paginaFinal" => "691"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11976440"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Systemic lupus erythematosus&#58; diagnosis and clinical management"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46; Fava"
                            1 => "M&#46; Petri"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaut.2018.11.001"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Autoimmun"
                        "fecha" => "2019"
                        "volumen" => "96"
                        "paginaInicial" => "1"
                        "paginaFinal" => "13"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30448290"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Comparison of neuron-specific enolase &#40;NSE&#41; serum level in patients with medullary thyroid carcinoma and healthy individuals&#58; case&#8211;control study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "R&#46; Abbasalipourkabir"
                            1 => "M&#46; Hedayati"
                            2 => "N&#46; Sheikh"
                            3 => "S&#46; Ebadi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Novel Clin Med"
                        "fecha" => "2022"
                        "volumen" => "1"
                        "paginaInicial" => "26"
                        "paginaFinal" => "31"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Complex syndromes&#44; ambivalent diagnosis&#44; and existential uncertainty&#58; the case of systemic lupus erythematosus &#40;SLE&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "A&#46; Stockl"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.socscimed.2007.05.016"
                      "Revista" => array:6 [
                        "tituloSerie" => "Soc Sci Med"
                        "fecha" => "2007"
                        "volumen" => "65"
                        "paginaInicial" => "1549"
                        "paginaFinal" => "1559"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17597274"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Medical&#8211;Surgical nursing&#58; clinical management for positive outcome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46; Black"
                            1 => "J&#46; Hawks"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:3 [
                        "fecha" => "2012"
                        "editorial" => "Saunders Elsevier"
                        "editorialLocalizacion" => "St&#46; Louis&#44; MO"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The systemic lupus erythematosus tri-nation study&#58; cumulative indirect costs"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46; Panopalis"
                            1 => "M&#46; Petri"
                            2 => "S&#46; Manzi"
                            3 => "D&#46;A&#46; Isenberg"
                            4 => "C&#46; Gordon"
                            5 => "J&#46;L&#46; Sen&#233;cal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Care Res"
                        "fecha" => "2007"
                        "volumen" => "57"
                        "paginaInicial" => "64"
                        "paginaFinal" => "70"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The case for transgenerational epigenetic inheritance in humans"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46;K&#46; Morgan"
                            1 => "E&#46; Whitelaw"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Mammal Genome"
                        "fecha" => "2008"
                        "volumen" => "19"
                        "paginaInicial" => "394"
                        "paginaFinal" => "397"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chromatin modifications and their function"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "T&#46; Kouzarides"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cell.2007.02.005"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cell"
                        "fecha" => "2007"
                        "volumen" => "128"
                        "paginaInicial" => "693"
                        "paginaFinal" => "705"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17320507"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epigenetics in autoimmune connective tissue diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "G&#46; Delsante"
                            1 => "P&#46; Fietta"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Acta Bio-Med"
                        "fecha" => "2014"
                        "volumen" => "85"
                        "paginaInicial" => "91"
                        "paginaFinal" => "107"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Environmental epigenetics"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "V&#46; Bollati"
                            1 => "A&#46; Baccarelli"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/hdy.2010.2"
                      "Revista" => array:6 [
                        "tituloSerie" => "Heredity"
                        "fecha" => "2010"
                        "volumen" => "105"
                        "paginaInicial" => "105"
                        "paginaFinal" => "112"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20179736"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The critical role of epigenetics in systemic lupus erythematosus and autoimmunity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "H&#46; Long"
                            1 => "H&#46; Yin"
                            2 => "L&#46; Wang"
                            3 => "M&#46;E&#46; Gershwin"
                            4 => "Q&#46; Lu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaut.2016.06.020"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Autoimmun"
                        "fecha" => "2016"
                        "volumen" => "74"
                        "paginaInicial" => "118"
                        "paginaFinal" => "138"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27396525"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The 1982 revised criteria for the classification of systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;M&#46; Tan"
                            1 => "A&#46;S&#46; Cohen"
                            2 => "J&#46;F&#46; Fries"
                            3 => "A&#46;T&#46; Masi"
                            4 => "D&#46;J&#46; Mcshane"
                            5 => "N&#46;F&#46; Rothfield"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/art.1780251101"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arthritis Rheum"
                        "fecha" => "1982"
                        "volumen" => "25"
                        "paginaInicial" => "1271"
                        "paginaFinal" => "1277"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7138600"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of ZAP-70&#44; LAT SLP-76&#44; and DNA methyltransferase 1 expression in CD4&#43; T cells of patients with systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "R&#46; Januchowski"
                            1 => "M&#46; Wudarski"
                            2 => "H&#46; Chwalinska-Sadowska"
                            3 => "P&#46;P&#46; Jagodzinski"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Clin Rheumatol"
                        "fecha" => "2008"
                        "volumen" => "27"
                        "paginaInicial" => "21"
                        "paginaFinal" => "27"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Abnormal DNA methylation in CD4&#43; T cells from patients with systemic lupus erythematosus&#44; systemic sclerosis&#44; and dermatomyositis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46; Lei"
                            1 => "Y&#46; Luo"
                            2 => "W&#46; Lei"
                            3 => "Y&#46; Luo"
                            4 => "K&#46; Yan"
                            5 => "S&#46; Zhao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1080/03009740902758875"
                      "Revista" => array:6 [
                        "tituloSerie" => "Scand J Rheumatol"
                        "fecha" => "2009"
                        "volumen" => "38"
                        "paginaInicial" => "369"
                        "paginaFinal" => "374"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19444718"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-21 and microRNA-148a contribute to DNA hypomethylation in lupus CD4&#43; T cells by directly and indirectly targeting DNA methyltransferase 1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W&#46; Pan"
                            1 => "S&#46; Zhu"
                            2 => "M&#46; Yuan"
                            3 => "H&#46; Cui"
                            4 => "L&#46; Wang"
                            5 => "X&#46; Luo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4049/jimmunol.0904060"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Immunol"
                        "fecha" => "2010"
                        "volumen" => "184"
                        "paginaInicial" => "6773"
                        "paginaFinal" => "6781"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20483747"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Protein phosphatase 2A enables expression of interleukin 17 &#40;IL-17&#41; through chromatin remodeling"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46;A&#46; Apostolidis"
                            1 => "T&#46; Rauen"
                            2 => "C&#46;M&#46; Hedrich"
                            3 => "G&#46;C&#46; Tsokos"
                            4 => "J&#46;C&#46; Crisp&#237;n"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2013"
                        "volumen" => "288"
                        "paginaInicial" => "26775"
                        "paginaFinal" => "26784"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oxidative stress T cell DNA methylation&#44; and lupus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Li"
                            1 => "G&#46; Gorelik"
                            2 => "F&#46;M&#46; Strickland"
                            3 => "B&#46;C&#46; Richardson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/art.38427"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arthritis Rheumatol"
                        "fecha" => "2014"
                        "volumen" => "66"
                        "paginaInicial" => "1574"
                        "paginaFinal" => "1582"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24577881"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The catalytic subunit of protein phosphatase 2A &#40;PP2Ac&#41; promotes DNA hypomethylation by suppressing the phosphorylated mitogen-activated protein kinase&#47;extracellular signal-regulated kinase &#40;ERK&#41; kinase &#40;MEK&#41;&#47;phosphorylated ERK&#47;DNMT1 protein pathway in T-cells from controls and systemic lupus erythematosus patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "K&#46; Sunahori"
                            1 => "K&#46; Nagpal"
                            2 => "C&#46;M&#46; Hedrich"
                            3 => "M&#46; Mizui"
                            4 => "L&#46;M&#46; Fitzgerald"
                            5 => "G&#46;C&#46; Tsokos"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2013"
                        "volumen" => "288"
                        "paginaInicial" => "21936"
                        "paginaFinal" => "21944"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gene-function studies in systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;C&#46; Crispin"
                            1 => "C&#46;M&#46; Hedrich"
                            2 => "G&#46;C&#46; Tsokos"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/nrrheum.2013.78"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Rev Rheumatol"
                        "fecha" => "2013"
                        "volumen" => "9"
                        "paginaInicial" => "476"
                        "paginaFinal" => "484"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23732569"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of depression among Iranian elderly&#58; a systematic review and meta-analysis of observational studies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Golboni"
                            1 => "H&#46; Mahmoodi"
                            2 => "V&#46; Baghi"
                            3 => "R&#46; Ghanei Gheshlagh"
                            4 => "S&#46; Valiee"
                            5 => "P&#46; Dalvand"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Novel Clin Med"
                        "fecha" => "2022"
                        "volumen" => "1"
                        "paginaInicial" => "70"
                        "paginaFinal" => "80"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Abnormal histone modification patterns in lupus CD4&#43; T cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46; Hu"
                            1 => "X&#46; Qiu"
                            2 => "Y&#46; Luo"
                            3 => "J&#46; Yuan"
                            4 => "Y&#46; Li"
                            5 => "W&#46; Lei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Rheumatol"
                        "fecha" => "2008"
                        "volumen" => "35"
                        "paginaInicial" => "804"
                        "paginaFinal" => "810"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18398941"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "JHDM1D and HDAC1-3 mRNA expression levels in peripheral blood mononuclear cells of patients with systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Nawrocki"
                            1 => "A&#46; Struga&#322;a"
                            2 => "P&#46; Piotrowski"
                            3 => "M&#46; Wudarski"
                            4 => "M&#46; Olesi&#324;ska"
                            5 => "P&#46; Jagodzi&#324;ski"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00393-015-1619-9"
                      "Revista" => array:6 [
                        "tituloSerie" => "Z Rheumatol"
                        "fecha" => "2015"
                        "volumen" => "74"
                        "paginaInicial" => "902"
                        "paginaFinal" => "910"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26347123"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased activity and expression of histone deacetylase 1 in relation to tumor necrosis factor-alpha in synovial tissue of rheumatoid arthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Kawabata"
                            1 => "K&#46; Nishida"
                            2 => "K&#46; Takasugi"
                            3 => "H&#46; Ogawa"
                            4 => "K&#46; Sada"
                            5 => "Y&#46; Kadota"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/ar3071"
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Res Ther"
                        "fecha" => "2010"
                        "volumen" => "12"
                        "paginaInicial" => "R133"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20609223"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Anti-rheumatic activities of histone deacetylase &#40;HDAC&#41; inhibitors in vivo in collagen-induced arthritis in rodents"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46;S&#46; Lin"
                            1 => "C&#46;Y&#46; Hu"
                            2 => "H&#46;Y&#46; Chan"
                            3 => "Y&#46;Y&#46; Liew"
                            4 => "H&#46;P&#46; Huang"
                            5 => "L&#46; Lepescheux"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/sj.bjp.0707165"
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Pharmacol"
                        "fecha" => "2007"
                        "volumen" => "150"
                        "paginaInicial" => "862"
                        "paginaFinal" => "872"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17325656"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Expression and function of histone deacetylases in rheumatoid arthritis synovial fibroblasts"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Horiuchi"
                            1 => "A&#46; Morinobu"
                            2 => "T&#46; Chin"
                            3 => "Y&#46; Sakai"
                            4 => "M&#46; Kurosaka"
                            5 => "S&#46; Kumagai"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3899/jrheum.081115"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Rheumatol"
                        "fecha" => "2009"
                        "volumen" => "36"
                        "paginaInicial" => "1580"
                        "paginaFinal" => "1589"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19531758"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "G&#46;C&#46; Tsokos"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMra1100359"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2011"
                        "volumen" => "365"
                        "paginaInicial" => "2110"
                        "paginaFinal" => "2121"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22129255"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Reproductive and menopausal factors and risk of systemic lupus erythematosus in women"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "K&#46;H&#46; Costenbader"
                            1 => "D&#46; Feskanich"
                            2 => "M&#46;J&#46; Stampfer"
                            3 => "E&#46;W&#46; Karlson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Rheumat"
                        "fecha" => "2007"
                        "volumen" => "56"
                        "paginaInicial" => "1251"
                        "paginaFinal" => "1262"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Altered function and differentiation of age-associated B cells contribute to the female bias in lupus mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46; Ricker"
                            1 => "M&#46; Manni"
                            2 => "D&#46; Flores-Castro"
                            3 => "D&#46; Jenkins"
                            4 => "S&#46; Gupta"
                            5 => "J&#46; Rivera-Correa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41467-020-20314-w"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Commun"
                        "fecha" => "2021"
                        "volumen" => "12"
                        "paginaInicial" => "1"
                        "paginaFinal" => "21"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33397941"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Functional conservation in genes and pathways linking ageing and immunity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "D&#46;K&#46; Fabian"
                            1 => "M&#46; Fuentealba"
                            2 => "H&#46;M&#46; D&#246;nerta&#351;"
                            3 => "L&#46; Partridge"
                            4 => "J&#46;M&#46; Thornton"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12979-020-00212-x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Immun Ageing"
                        "fecha" => "2021"
                        "volumen" => "18"
                        "paginaInicial" => "1"
                        "paginaFinal" => "8"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33390183"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Rheumatoid arthritis autoantibodies and their association with age and sex"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46; Pertsinidou"
                            1 => "V&#46;A&#46; Manivel"
                            2 => "H&#46; Westerlind"
                            3 => "L&#46; Klareskog"
                            4 => "L&#46; Alfredsson"
                            5 => "L&#46; Mathsson-Alm"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.55563/clinexprheumatol/4bcmdb"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Exp Rheumatol"
                        "fecha" => "2021"
                        "volumen" => "39"
                        "paginaInicial" => "879"
                        "paginaFinal" => "882"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33822709"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Reproductive factors and risk of systemic lupus erythematosus&#58; nationwide cohort study in Denmark"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "C&#46;J&#46; Ulff-M&#248;ller"
                            1 => "K&#46;T&#46; J&#248;rgensen"
                            2 => "B&#46;V&#46; Pedersen"
                            3 => "N&#46;M&#46; Nielsen"
                            4 => "M&#46; Frisch"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3899/jrheum.090002"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Rheumatol"
                        "fecha" => "2009"
                        "volumen" => "36"
                        "paginaInicial" => "1903"
                        "paginaFinal" => "1909"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19567628"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Being overweight or obese and risk of developing rheumatoid arthritis among women&#58; a prospective cohort study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Lu"
                            1 => "L&#46;T&#46; Hiraki"
                            2 => "J&#46;A&#46; Sparks"
                            3 => "S&#46; Malspeis"
                            4 => "C&#46;Y&#46; Chen"
                            5 => "J&#46;A&#46; Awosogba"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/annrheumdis-2014-205459"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Rheum Dis"
                        "fecha" => "2014"
                        "volumen" => "73"
                        "paginaInicial" => "1914"
                        "paginaFinal" => "1922"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25057178"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Associations between adipokines in arthritic disease and implications for obesity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "I&#46;J&#46; MacDonald"
                            1 => "S&#46;C&#46; Liu"
                            2 => "C&#46;C&#46; Huang"
                            3 => "S&#46;J&#46; Kuo"
                            4 => "C&#46;H&#46; Tsai"
                            5 => "C&#46;H&#46; Tang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/ijms20061505"
                      "Revista" => array:5 [
                        "tituloSerie" => "Int J Mol Sci"
                        "fecha" => "2019"
                        "volumen" => "20"
                        "paginaInicial" => "1505"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30917508"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased levels of osteopontin in sputum supernatant of smoking asthmatics"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Hillas"
                            1 => "S&#46; Loukides"
                            2 => "K&#46; Kostikas"
                            3 => "D&#46; Simoes"
                            4 => "V&#46; Petta"
                            5 => "E&#46; Konstantellou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cyto.2012.10.002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cytokine"
                        "fecha" => "2013"
                        "volumen" => "61"
                        "paginaInicial" => "251"
                        "paginaFinal" => "255"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23098767"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Inflammation&#44; adiponectin&#44; obesity and cardiovascular risk"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Mangge"
                            1 => "G&#46; Almer"
                            2 => "M&#46; Truschnig-Wilders"
                            3 => "A&#46; Schmidt"
                            4 => "R&#46; Gasser"
                            5 => "D&#46; Fuchs"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2174/092986710794183006"
                      "Revista" => array:6 [
                        "tituloSerie" => "Curr Med Chem"
                        "fecha" => "2010"
                        "volumen" => "17"
                        "paginaInicial" => "4511"
                        "paginaFinal" => "4520"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21062254"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cigarette smoking and the risk of systemic lupus erythematosus&#58; a meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46;H&#46; Costenbader"
                            1 => "D&#46;J&#46; Kim"
                            2 => "J&#46; Peerzada"
                            3 => "S&#46; Lockman"
                            4 => "D&#46; Nobles-Knight"
                            5 => "M&#46; Petri"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/art.20049"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arthritis Rheumat"
                        "fecha" => "2004"
                        "volumen" => "50"
                        "paginaInicial" => "849"
                        "paginaFinal" => "857"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15022327"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack679034"
        "titulo" => "Acknowledgment"
        "texto" => "<p id="par0160" class="elsevierStylePara elsevierViewall">The authors take this opportunity to thank the Department of Clinical Biochemistry&#44; Faculty of Medicine&#44; Rafsanjan University of Medical Sciences&#44; Rafsanjan&#44; Iran for their financial and technical support&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/1699258X/0000001900000007/v1_202307241059/S1699258X23000384/v1_202307241059/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "17499"
    "tipo" => "SECCION"
    "es" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "es"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/1699258X/0000001900000007/v1_202307241059/S1699258X23000384/v1_202307241059/en/main.pdf?idApp=UINPBA00004M&text.app=https://reumatologiaclinica.org/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X23000384?idApp=UINPBA00004M"
]
Compartir
Información de la revista
Vol. 19. Núm. 7.
Páginas 358-362 (agosto - septiembre 2023)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Vol. 19. Núm. 7.
Páginas 358-362 (agosto - septiembre 2023)
Original Article
Evaluation of epigenetic-related gene expression (DNMT, HDAC1) in Iranian patients with systemic lupus erythematosus
Evaluación de la expresión de los genes relacionados con la epigenética (DNMT, HDAC1) en pacientes iraníes con lupus eritematoso sistémico
Mitra Abbasifarda,b, Fahimeh Mohammadiranjbarc, Maryam Mohammad-Sadeghipourd, Mehdi Mahmoodid, Gholamhossein Hassanshahie, Jennifer Swannf, Sadegh Zareic, Reza Hosseiniarag, Mohammad Reza Hajizadehc,e,
Autor para correspondencia
hajizadehus@yahoo.com

Corresponding author.
a Molecular Medicine Research Center, Research Institute of Basic Medical Sciences, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
b Department of Internal Medicine, Ali-Ibn AbiTalib hospital, School of Medicine, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
c Department of Clinical Biochemistry, Faculty of Medicine, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
d Department of Clinical Biochemistry, Afzalipour School of Medicine, Kerman University of Medical Sciences, Kerman, Iran
e Molecular Medicine Research Centre, Institute of Basics Medical Sciences, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
f Biological Sciences, Interim Director of Africana Studies, Williams Hall, Lehigh University, Bethlehem, United States
g Faculty of Medicine and Health Care, Al-Farabi Kazakh National University, Almaty, Kazakhstan

Estadísticas

Siga este enlace para acceder al texto completo del artículo

Original Article
Evaluation of epigenetic-related gene expression (DNMT, HDAC1) in Iranian patients with systemic lupus erythematosus
Evaluación de la expresión de los genes relacionados con la epigenética (DNMT, HDAC1) en pacientes iraníes con lupus eritematoso sistémico
Mitra Abbasifarda,b, Fahimeh Mohammadiranjbarc, Maryam Mohammad-Sadeghipourd, Mehdi Mahmoodid, Gholamhossein Hassanshahie, Jennifer Swannf, Sadegh Zareic, Reza Hosseiniarag, Mohammad Reza Hajizadehc,e,
Autor para correspondencia
hajizadehus@yahoo.com

Corresponding author.
a Molecular Medicine Research Center, Research Institute of Basic Medical Sciences, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
b Department of Internal Medicine, Ali-Ibn AbiTalib hospital, School of Medicine, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
c Department of Clinical Biochemistry, Faculty of Medicine, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
d Department of Clinical Biochemistry, Afzalipour School of Medicine, Kerman University of Medical Sciences, Kerman, Iran
e Molecular Medicine Research Centre, Institute of Basics Medical Sciences, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
f Biological Sciences, Interim Director of Africana Studies, Williams Hall, Lehigh University, Bethlehem, United States
g Faculty of Medicine and Health Care, Al-Farabi Kazakh National University, Almaty, Kazakhstan
Leído
1015
Veces
se ha leído el artículo
352
Total PDF
663
Total HTML
Compartir estadísticas
 array:23 [
  "pii" => "S1699258X23000384"
  "issn" => "1699258X"
  "doi" => "10.1016/j.reuma.2022.12.008"
  "estado" => "S300"
  "fechaPublicacion" => "2023-08-01"
  "aid" => "1672"
  "copyrightAnyo" => "2023"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Reumatol Clin. 2023;19:358-62"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "en" => array:18 [
      "pii" => "S2173574323000758"
      "issn" => "21735743"
      "doi" => "10.1016/j.reumae.2022.12.006"
      "estado" => "S300"
      "fechaPublicacion" => "2023-08-01"
      "aid" => "1672"
      "documento" => "article"
      "crossmark" => 1
      "subdocumento" => "fla"
      "cita" => "Reumatol Clin. 2023;19:358-62"
      "abierto" => array:3 [
        "ES" => false
        "ES2" => false
        "LATM" => false
      ]
      "gratuito" => false
      "lecturas" => array:1 [
        "total" => 0
      ]
      "en" => array:13 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
        "titulo" => "Evaluation of epigenetic-related gene expression &#40;DNMT&#44; HDAC1&#41; in Iranian patients with systemic lupus erythematosus"
        "tienePdf" => "en"
        "tieneTextoCompleto" => "en"
        "tieneResumen" => array:2 [
          0 => "en"
          1 => "es"
        ]
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "358"
            "paginaFinal" => "362"
          ]
        ]
        "titulosAlternativos" => array:1 [
          "es" => array:1 [
            "titulo" => "Evaluaci&#243;n de la expresi&#243;n de los genes relacionados con la epigen&#233;tica &#40;DNMT&#44; HDAC1&#41; en pacientes iran&#237;es con lupus eritematoso sist&#233;mico"
          ]
        ]
        "contieneResumen" => array:2 [
          "en" => true
          "es" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "en" => true
        ]
        "contienePdf" => array:1 [
          "en" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0005"
            "etiqueta" => "Fig&#46; 1"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr1.jpeg"
                "Alto" => 964
                "Ancho" => 1591
                "Tamanyo" => 160069
              ]
            ]
            "descripcion" => array:1 [
              "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">The mean rank of HDAC1 and DNMT genes in systemic lupus erythematosus &#40;SLE&#41; and control groups&#46; There is no significant difference between groups&#46; Results are obtained from three independent experiments and data are presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; The significance level was <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#706;<span class="elsevierStyleHsp" style=""></span>0&#46;05 &#40;HDAC1&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;94&#41;&#44; &#40;DNMT&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;21&#41;&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Mitra Abbasifard, Fahimeh Mohammadiranjbar, Maryam Mohammad-Sadeghipour, Mehdi Mahmoodi, Gholamhossein Hassanshahi, Jennifer Swann, Sadegh Zarei, Reza Hosseiniara, Mohammad Reza Hajizadeh"
            "autores" => array:9 [
              0 => array:2 [
                "nombre" => "Mitra"
                "apellidos" => "Abbasifard"
              ]
              1 => array:2 [
                "nombre" => "Fahimeh"
                "apellidos" => "Mohammadiranjbar"
              ]
              2 => array:2 [
                "nombre" => "Maryam"
                "apellidos" => "Mohammad-Sadeghipour"
              ]
              3 => array:2 [
                "nombre" => "Mehdi"
                "apellidos" => "Mahmoodi"
              ]
              4 => array:2 [
                "nombre" => "Gholamhossein"
                "apellidos" => "Hassanshahi"
              ]
              5 => array:2 [
                "nombre" => "Jennifer"
                "apellidos" => "Swann"
              ]
              6 => array:2 [
                "nombre" => "Sadegh"
                "apellidos" => "Zarei"
              ]
              7 => array:2 [
                "nombre" => "Reza"
                "apellidos" => "Hosseiniara"
              ]
              8 => array:2 [
                "nombre" => "Mohammad Reza"
                "apellidos" => "Hajizadeh"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "en"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S1699258X23000384"
          "doi" => "10.1016/j.reuma.2022.12.008"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => true
            "ES2" => true
            "LATM" => true
          ]
          "gratuito" => true
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X23000384?idApp=UINPBA00004M"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574323000758?idApp=UINPBA00004M"
      "url" => "/21735743/0000001900000007/v1_202309042019/S2173574323000758/v1_202309042019/en/main.assets"
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1699258X22002273"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2022.10.001"
    "estado" => "S300"
    "fechaPublicacion" => "2023-08-01"
    "aid" => "1650"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46; and Sociedad Espa&#241;ola de Reumatolog&#237;a y Colegio Mexicano de Reumatolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Reumatol Clin. 2023;19:363-73"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Relationship between epicardial adipose tissue&#44; systemic inflammatory diseases&#44; and subclinical atheromatosis&#58; A systematic review"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "363"
          "paginaFinal" => "373"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Relaci&#243;n entre tejido adiposo epic&#225;rdico&#44; enfermedades inflamatorias sist&#233;micas y ateromatosis subcl&#237;nica&#58; una revisi&#243;n sistem&#225;tica"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0020"
          "etiqueta" => "Fig&#46; 4"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr4.jpeg"
              "Alto" => 3635
              "Ancho" => 3341
              "Tamanyo" => 765446
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Sensitivity analysis&#46; &#40;A&#41; EAT thickness&#59; &#40;B&#41; EAT volume&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Walter Masson, Augusto Lavalle-Cobo, Leandro Barbagelata, Martin Lobo, Juan Patricio Nogueira"
          "autores" => array:5 [
            0 => array:2 [
              "nombre" => "Walter"
              "apellidos" => "Masson"
            ]
            1 => array:2 [
              "nombre" => "Augusto"
              "apellidos" => "Lavalle-Cobo"
            ]
            2 => array:2 [
              "nombre" => "Leandro"
              "apellidos" => "Barbagelata"
            ]
            3 => array:2 [
              "nombre" => "Martin"
              "apellidos" => "Lobo"
            ]
            4 => array:2 [
              "nombre" => "Juan Patricio"
              "apellidos" => "Nogueira"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2173574323000667"
        "doi" => "10.1016/j.reumae.2022.10.003"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574323000667?idApp=UINPBA00004M"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X22002273?idApp=UINPBA00004M"
    "url" => "/1699258X/0000001900000007/v1_202307241059/S1699258X22002273/v1_202307241059/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S1699258X22002327"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2022.10.003"
    "estado" => "S300"
    "fechaPublicacion" => "2023-08-01"
    "aid" => "1655"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Reumatol Clin. 2023;19:351-7"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Description of a single centre cohort of patients with systemic sclerosis from the University Hospital of Buenos Aires and factors associated with lung function deterioration&#46; A retrospective study"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "351"
          "paginaFinal" => "357"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Descripci&#243;n de una cohorte de pacientes con esclerosis sist&#233;mica del Hospital de la Universidad de Buenos Aires y factores asociados al deterioro de la funci&#243;n pulmonar&#46; Un estudio retrospectivo"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1985
              "Ancho" => 1675
              "Tamanyo" => 136223
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Flow chart of evaluated SSc patients&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Juan I&#46; Enghelmayer, Mar&#237;a Jos&#233; L&#243;pez Meiller, Ail&#237;n Vallejos, Federico Felder, Mar&#237;a Milena Pertuz, Tamara Arias, Cora G&#46; Legarreta, Silvana Acu&#241;a, Sebasti&#225;n Leiva, Vanesa Barrios, Diana Dubinsky"
          "autores" => array:11 [
            0 => array:2 [
              "nombre" => "Juan I&#46;"
              "apellidos" => "Enghelmayer"
            ]
            1 => array:2 [
              "nombre" => "Mar&#237;a Jos&#233;"
              "apellidos" => "L&#243;pez Meiller"
            ]
            2 => array:2 [
              "nombre" => "Ail&#237;n"
              "apellidos" => "Vallejos"
            ]
            3 => array:2 [
              "nombre" => "Federico"
              "apellidos" => "Felder"
            ]
            4 => array:2 [
              "nombre" => "Mar&#237;a Milena"
              "apellidos" => "Pertuz"
            ]
            5 => array:2 [
              "nombre" => "Tamara"
              "apellidos" => "Arias"
            ]
            6 => array:2 [
              "nombre" => "Cora G&#46;"
              "apellidos" => "Legarreta"
            ]
            7 => array:2 [
              "nombre" => "Silvana"
              "apellidos" => "Acu&#241;a"
            ]
            8 => array:2 [
              "nombre" => "Sebasti&#225;n"
              "apellidos" => "Leiva"
            ]
            9 => array:2 [
              "nombre" => "Vanesa"
              "apellidos" => "Barrios"
            ]
            10 => array:2 [
              "nombre" => "Diana"
              "apellidos" => "Dubinsky"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2173574323000680"
        "doi" => "10.1016/j.reumae.2022.10.004"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574323000680?idApp=UINPBA00004M"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X22002327?idApp=UINPBA00004M"
    "url" => "/1699258X/0000001900000007/v1_202307241059/S1699258X22002327/v1_202307241059/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "Evaluation of epigenetic-related gene expression &#40;DNMT&#44; HDAC1&#41; in Iranian patients with systemic lupus erythematosus"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "358"
        "paginaFinal" => "362"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Mitra Abbasifard, Fahimeh Mohammadiranjbar, Maryam Mohammad-Sadeghipour, Mehdi Mahmoodi, Gholamhossein Hassanshahi, Jennifer Swann, Sadegh Zarei, Reza Hosseiniara, Mohammad Reza Hajizadeh"
        "autores" => array:9 [
          0 => array:3 [
            "nombre" => "Mitra"
            "apellidos" => "Abbasifard"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Fahimeh"
            "apellidos" => "Mohammadiranjbar"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Maryam"
            "apellidos" => "Mohammad-Sadeghipour"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Mehdi"
            "apellidos" => "Mahmoodi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Gholamhossein"
            "apellidos" => "Hassanshahi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Jennifer"
            "apellidos" => "Swann"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0030"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Sadegh"
            "apellidos" => "Zarei"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Reza"
            "apellidos" => "Hosseiniara"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">g</span>"
                "identificador" => "aff0035"
              ]
            ]
          ]
          8 => array:4 [
            "nombre" => "Mohammad Reza"
            "apellidos" => "Hajizadeh"
            "email" => array:1 [
              0 => "hajizadehus@yahoo.com"
            ]
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:7 [
          0 => array:3 [
            "entidad" => "Molecular Medicine Research Center&#44; Research Institute of Basic Medical Sciences&#44; Rafsanjan University of Medical Sciences&#44; Rafsanjan&#44; Iran"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Department of Internal Medicine&#44; Ali-Ibn AbiTalib hospital&#44; School of Medicine&#44; Rafsanjan University of Medical Sciences&#44; Rafsanjan&#44; Iran"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Clinical Biochemistry&#44; Faculty of Medicine&#44; Rafsanjan University of Medical Sciences&#44; Rafsanjan&#44; Iran"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Department of Clinical Biochemistry&#44; Afzalipour School of Medicine&#44; Kerman University of Medical Sciences&#44; Kerman&#44; Iran"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Molecular Medicine Research Centre&#44; Institute of Basics Medical Sciences&#44; Rafsanjan University of Medical Sciences&#44; Rafsanjan&#44; Iran"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
          5 => array:3 [
            "entidad" => "Biological Sciences&#44; Interim Director of Africana Studies&#44; Williams Hall&#44; Lehigh University&#44; Bethlehem&#44; United States"
            "etiqueta" => "f"
            "identificador" => "aff0030"
          ]
          6 => array:3 [
            "entidad" => "Faculty of Medicine and Health Care&#44; Al-Farabi Kazakh National University&#44; Almaty&#44; Kazakhstan"
            "etiqueta" => "g"
            "identificador" => "aff0035"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Evaluaci&#243;n de la expresi&#243;n de los genes relacionados con la epigen&#233;tica &#40;DNMT&#44; HDAC1&#41; en pacientes iran&#237;es con lupus eritematoso sist&#233;mico"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 964
            "Ancho" => 1591
            "Tamanyo" => 160069
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">The mean rank of HDAC1 and DNMT genes in systemic lupus erythematosus &#40;SLE&#41; and control groups&#46; There is no significant difference between groups&#46; Results are obtained from three independent experiments and data are presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46; The significance level was <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#706;<span class="elsevierStyleHsp" style=""></span>0&#46;05 &#40;HDAC1&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;94&#41;&#44; &#40;DNMT&#58; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;21&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Systemic lupus erythematosus &#40;SLE&#41; is an autoimmune disease that is associated with vascular and connective tissue inflammation&#46; SLE affects a variety of organs including the joints&#44; skin&#44; kidneys&#44; and heart&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">1</span></a> SLE can also cause significant problems in the nervous system&#46; SLE occurs all over the world&#44; with a prevalence of 20&#8211;150 cases per 100&#44;000 people&#46; In Iran&#44; SLE occurs in about 40 cases per 100&#44;000 people&#46;<a class="elsevierStyleCrossRefs" href="#bib0200"><span class="elsevierStyleSup">2&#44;3</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">SLE may affect active B cells and T cells causing abnormal differentiation&#46; Increased activation of these cells leads to the production of antibodies against nucleic acids&#44; proteins&#44; and ribonucleoproteins&#46; Clinical symptoms vary based on the type of damaged tissue&#46; SLE is also determined by hereditary and environmental factors including ultraviolet radiation and drugs&#46;<a class="elsevierStyleCrossRefs" href="#bib0210"><span class="elsevierStyleSup">4&#44;5</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">SLE causes extensive damage to the connective tissue&#44; blood vessels&#44; and serous membranes&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">6</span></a> The progression of SLE is unpredictable&#44; involves many changes that lead to progressive disability in young patients&#44; and has a variety of harmful effects on physical&#44; psychological&#44; and social health fields&#46;<a class="elsevierStyleCrossRefs" href="#bib0225"><span class="elsevierStyleSup">7&#44;8</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">Epigenetics is the study of the heritable changes in the function and expression of genes&#44; in the absence of changes in the DNA sequence&#46; Epigenetic mechanisms include DNA methylation&#44; histone modification&#44; and alteration in transcription factors<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">9</span></a> that lead to the expression or non-expression of genes&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">10</span></a> Epigenetic changes can be determined by evaluating DNA methyltransferase &#40;DNMT&#41; and histone deacetylase 1 &#40;HDAC1&#41;&#44; enzymes related to DNA methylation and acetylation&#46; The reduction of DNMT1 expression and enhancement of methylation-sensitive autoimmune genes activation in T cells of patients with SLE could be a part of epigenetic changes&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">11</span></a> The relationship between DNMT1 and HDAC1 and SLE and other autoimmune diseases has been reported&#44;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">11</span></a> suggesting the study of epigenetic mechanisms in regulating gene expression and the effect of drugs on these genes&#46; Different environmental pollutions can lead to epigenetic changes&#44;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">12</span></a> and that&#44; in turn&#44; may cause autoimmune diseases such as SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">13</span></a> Rafsanjan city in the southeast of Iran is prone to environmental pollution&#44; including agricultural pesticides and contaminants from Sarcheshmeh copper mine pollutants which may contribute to epigenetic changes&#46; Therefore&#44; the evaluation of related epigenetic genes in patients in Rafsanjan with SLE is warranted&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">In this study&#44; we examined the DNMT and HDAC1 genes expression in Iranian SLE patients referred to the Rafsanjan rheumatology clinic&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Study setting and participants</span><p id="par0030" class="elsevierStylePara elsevierViewall">A matched case&#8211;control study design was used&#46; During three month &#40;1 Oct to 30 Dec 2020&#41;&#44; sixteen Iranian patients with SLE admitted to rheumatology clinic in Rafsanjan city&#44; the southeast of Iran&#44; were included in the case group in a consecutive manner&#46; For the control group&#44; sixteen healthy people from the hospital staff of Rafsanjan city selected by random method&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Inclusion and exclusion criteria for case group</span><p id="par0035" class="elsevierStylePara elsevierViewall">The patients fulfilled the American College of Rheumatology diagnostic criteria for SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">14</span></a> Then 16 patients were appraised with clinical examination &#40;there are no more patients with SLE in Rafsanjan city&#41;&#44; and laboratory tests such as ESR&#44; CRP&#44; RF&#44; anti CCP&#44; ANA&#44; anti DS DNA were performed&#46; A rheumatologist then confirmed the results&#46; The voluntary and informed participation in the case group were considered&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Inclusion and exclusion criteria for control group</span><p id="par0040" class="elsevierStylePara elsevierViewall">Sixteen adult healthy people &#40;18&#8211;65 years old&#41; who had no ACR criteria were recruited from the hospital staff of Rafsanjan&#46; Subjects that had used anti-inflammatory drugs in the last three months or had the main symptoms of SLE in their family were excluded from the control group&#46; The voluntary and informed participation in the control group were considered&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Samples size</span><p id="par0045" class="elsevierStylePara elsevierViewall">According to the inclusion and exclusion criteria&#44; all adult SLE patients &#40;18&#8211;65 years old&#41; in Rafsanjan city during 1 Oct to 30 Dec 2020 were enrolled as the case group&#46; The ratio of control to case was 1&#58;1&#44; and matching age and sex&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Collecting data</span><p id="par0050" class="elsevierStylePara elsevierViewall">Demographic and epidemiologic data including age&#44; sex&#44; academic education &#40;BSc&#44; MSc&#44; Ph&#46;D&#46;&#41;&#44; smoking at least one cigarette a day&#44; body mass index &#40;BMI&#41;&#44; and job status were matched between the two groups&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Experimental procedure</span><p id="par0055" class="elsevierStylePara elsevierViewall">A 10<span class="elsevierStyleHsp" style=""></span>ml blood sample was obtained from each subject in both groups&#46; A sample of the blood &#40;3<span class="elsevierStyleHsp" style=""></span>ml&#41; was reserved for ELISA assay&#44; and an additional sample &#40;7<span class="elsevierStyleHsp" style=""></span>ml&#41; was collected in EDTA tubes for the real-time PCR method&#46; Clotted blood was centrifuged for 3&#8211;5<span class="elsevierStyleHsp" style=""></span>min with 3000<span class="elsevierStyleHsp" style=""></span>rpm to separate the serum&#46; The serum was kept at &#8722;20<span class="elsevierStyleHsp" style=""></span>&#176;C until analyzed for ANA and CCP via ELSA kits &#40;Germany&#44; AESKU&#41; according to the kit protocol&#46;</p><p id="par0060" class="elsevierStylePara elsevierViewall">An RNA extraction kit was applied to extract total RNA from peripheral blood samples&#46; Extracted RNA quality was determined via electrophoresis on the ethidium bromide pretreated agarose gels&#46; Absorption was measured at 260&#47;280<span class="elsevierStyleHsp" style=""></span>nm by a spectrophotometer&#46; cDNA was synthesized using a cDNA synthesis kit &#40;Parstous&#44; Iran&#41; according to the manufacturer&#39;s instructions&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">5<span class="elsevierStyleHsp" style=""></span>&#956;l SYBR of green master mix &#40;Parstous&#44; Iran&#41;&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;l of the generated cDNA&#44; and 0&#46;8<span class="elsevierStyleHsp" style=""></span>&#956;M of forward and reverse appropriate primers &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41; were mixed for real-time quantitative PCR&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0070" class="elsevierStylePara elsevierViewall">The cycling program on a BIO-RAD CFX96 system &#40;Bio-Rad Company&#44; USA&#41; was completed as follows&#58; one cycle of 94<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; 45 cycles of 94<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>s&#44; and 45 cycles for 34<span class="elsevierStyleHsp" style=""></span>s&#46; This cycle was performed in triplicate&#44; and &#946;-actin was evaluated as a housekeeping gene&#46; 2<span class="elsevierStyleSup">&#8722;&#916;&#916;ct</span> formula was applied for the relative amounting of the PCR product&#46; The dissociation stages&#44; melting curves&#44; and quantitative analyses of the data were performed using CFX manager software version 1&#46;1&#46;308&#46;111 &#40;Bio-Rad&#44; USA&#41;&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Statistical analysis</span><p id="par0075" class="elsevierStylePara elsevierViewall">The continuous variables were expressed as the mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#44; and the categorical variables were presented as a percentage and frequency&#46; Because the data showed a non-normal distribution&#44; the Mann&#8211;Whitney test was used to compare the parameters between patients and health groups&#46; The relations between parameters were evaluated using the Pearson correlation coefficient&#46; All statistical analyses were performed with SPSS &#40;version 16&#46;0&#44; SPSS Inc&#44; Chicago&#44; IL&#44; USA&#41;&#46; A &#8220;<span class="elsevierStyleItalic">P</span>-value&#8221; less than 0&#46;05 was considered significant&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Ethical considerations</span><p id="par0080" class="elsevierStylePara elsevierViewall">The study was conducted in accordance with the Declaration of Helsinki&#46; Institutional Review Board approval &#40;code&#58; IR&#46;RUMS&#46;REC&#46;1396&#46;119&#41; was obtained &#40;April 2020&#41;&#46; The present study did not interfere with the process of diagnosis and treatment of patients and all participants signed an informed consent form&#46;</p></span></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Results</span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Demographic and epidemiological characteristics</span><p id="par0085" class="elsevierStylePara elsevierViewall">This case-control study included 16 patients with SLE &#40;case group&#41; and 16 healthy people &#40;control group&#41;&#46; Demographic and epidemiological data were matched between two groups &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; and provided in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; Most subjects in case and control groups were women&#44; married and housekeepers&#46; One person in the control group was a tobacco smoker&#46; The mean age was 43&#46;2<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>11&#46;4 years and 38&#46;9<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>12&#46;1 years for case and control groups&#44; respectively &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;31&#41;&#46; 56&#46;2&#37; and 37&#46;5&#37; of the subjects were more than 41 years old in case and control group&#44; respectively&#46; The highest percentage and frequency for BMI in patients was 25&#8211;29&#46;5&#44; with 43&#46;8&#37; that showed most of the patients are overweight&#46; In the control group&#44; healthy BMI &#40;9&#46;5&#8211;24&#46;18&#41; was in first order with 45&#37;&#46; The minority of both groups had academic education &#40;BSc&#44; MSc&#44; PhD&#41;&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Experimental findings</span><p id="par0090" class="elsevierStylePara elsevierViewall">The expression of DNMT and HDAC1 genes were evaluated&#44; via real-time PCR assay&#44; and patients with SLE were compared to healthy group&#46; The mean rank of DNMT gene expression was 17&#46;63 in the SLE group and 17&#46;39 in the control group&#46; Mann&#8211;Whitney statistical test reported that the expression of this gene did not differ significantly between SLE and control groups &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;21&#41;&#46; The mean rank in the expression of the HDAC1 gene was 20&#46;33 and 16&#46;25 in SLE and control groups&#44; respectively&#46; While HDAC1 gene expression was enhanced in the SLE group&#44; this enhancement was not statistically significant &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;94&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Discussion</span><p id="par0095" class="elsevierStylePara elsevierViewall">Comparison of serum levels of the epigenetic genes of 16 patients with SLE and 16 healthy people indicate that the expression of the DNMT gene did not differ between SLE and control groups&#46; While HDAC1 gene expression increased in the SLE group this increase was not significant&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">In contrast with our finding&#44; previous studies have evaluated DNA methylation in T cells from SLE patients and found the mean DNMT gene expression significantly diminished&#46;<a class="elsevierStyleCrossRefs" href="#bib0265"><span class="elsevierStyleSup">15&#44;16</span></a> Pan et al&#46; &#40;2010&#41; also demonstrated that the DNMT gene reduced in patients with SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">17</span></a> Decreasing DNMT gene expression could be the result of inhibition of ERK pathway signaling&#44; which causes overexpression of some genes that improve the SLE disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0280"><span class="elsevierStyleSup">18&#8211;20</span></a> DNMT is reduced in older people and could be a cause of rheumatoid disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0295"><span class="elsevierStyleSup">21&#44;22</span></a></p><p id="par0105" class="elsevierStylePara elsevierViewall">Consistent with our study&#44; Hu et al&#46;&#44; reported that HDAC1 gene expression was not significantly different between patients with SLE and healthy people&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">23</span></a> Nawrocki et al&#46;&#44; found HDAC1-3 mRNA expression significantly enhanced in patients with SLE&#46;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">24</span></a> HDAC has been shown to exacerbate inflammation in vitro&#44; and HDAC inhibitors can help in the treatment of inflammation in the arthritis&#46;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">25</span></a> Lin et al&#46;&#44; indicated that overexpression of HDAC1 might be a reason for the inflammation&#44; and an HDAC inhibitor could reduce inflammation or disease progression&#46;<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">26</span></a> Horiuchi et al&#46;&#44; studied the expression of HDAC in rheumatoid arthritis synovial fibroblasts and reported that HDAC1 enhanced synovial fibroblasts&#46;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">27</span></a> Kawabata et al&#46;&#44; found that HDAC1 increased in synovial tissue and suggested that the overexpression of HDAC1 might contribute to synovial inflammation&#46;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">25</span></a></p><p id="par0110" class="elsevierStylePara elsevierViewall">In this matched case&#8211;control study&#59; most patients were women &#40;93&#46;7&#37;&#41;&#44; were over 41 years old &#40;56&#46;2&#37;&#41; and most patients were overweight &#40;BMI<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>25&#8211;29&#46;9<span class="elsevierStyleHsp" style=""></span>kg&#47;m<span class="elsevierStyleSup">2</span>&#41; &#40;43&#46;8&#37;&#41; and obese &#40;BMI<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>30<span class="elsevierStyleHsp" style=""></span>kg&#47;m<span class="elsevierStyleSup">2</span>&#41; &#40;25&#37;&#41;&#46; The majority of patients in our study were women consistent with reports that SLE is more prevalent among females&#46;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">28</span></a> SLE in women has been associated with a number of reproductive factors including oral contraceptive use&#44; older age at menarche &#40;&#8804;10 years&#41; and the adoption of hormone replacement therapy following menopause&#46;<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">29</span></a> And sex specific changes in aging B cells that precede autoimmune disease induce have also been identified in mice&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">30</span></a></p><p id="par0115" class="elsevierStylePara elsevierViewall">The population in this study was middle-aged and aging has been associated with a decline in immunity<a class="elsevierStyleCrossRef" href="#bib0345"><span class="elsevierStyleSup">31</span></a> that includes changes in autoantibody levels<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">32</span></a> that could be influencing the progression of the disease&#46; Obesity has also been shown to contribute to SLE<a class="elsevierStyleCrossRefs" href="#bib0330"><span class="elsevierStyleSup">28&#44;33</span></a> and rheumatoid arthritis<a class="elsevierStyleCrossRef" href="#bib0360"><span class="elsevierStyleSup">34</span></a> &#8211; another autoimmune disease &#8211; via changes in adipokines&#44; inflammatory cytokines&#44; released from adipose tissue&#46;<a class="elsevierStyleCrossRefs" href="#bib0365"><span class="elsevierStyleSup">35&#44;36</span></a> Adipose tissue also contains aromatase enzymes and enhances to steroid hormone levels by converting androgens to estrogens&#46;<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">37</span></a></p><p id="par0120" class="elsevierStylePara elsevierViewall">Although smoking has been shown to be a risk factor for SLE&#44;<a class="elsevierStyleCrossRef" href="#bib0380"><span class="elsevierStyleSup">38</span></a> none of the patients in the present study smoked&#46; Part of this is related to Iranian culture&#44; where smoking is considered to be unflattering to women&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Conclusion</span><p id="par0125" class="elsevierStylePara elsevierViewall">In the present study&#44; although the expression of DNMT was not different between case and control groups&#44; the expression of HDAC1 increased in SLE patients&#46; A larger sample size might support the overexpression of HDAC1 as a diagnostic method for SLE disease as this gene is related to inflammation and rheumatoid disease&#46; Evaluation of other genes that are related to SLE disease is essential and may help an accurate diagnosis of the disease&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">Availability of data and materials</span><p id="par0130" class="elsevierStylePara elsevierViewall">The data used in this study are available from the corresponding author on request&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0160">Ethics approval and consent to participate</span><p id="par0135" class="elsevierStylePara elsevierViewall">The study was conducted in accordance with the Declaration of Helsinki and Institutional Review Board approval has been obtained &#40;IR&#46;RUMS&#46;REC&#46;1396&#46;119&#41;&#46;</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0165">Consent for publication</span><p id="par0140" class="elsevierStylePara elsevierViewall">By submitting this document&#44; the authors declare their consent for the final accepted version of the manuscript to be considered for publication&#46;</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0170">Authors&#8217; contributions</span><p id="par0145" class="elsevierStylePara elsevierViewall">MA and MRH were responsible for the study concept and design&#46; MA&#44; FM&#44; MMS&#44; and GH led data collection&#46; MA&#44; FM&#44; and MRH were responsible for the analysis and interpretation of data&#46; MA and MM wrote the first draft&#46; JS&#44; MMS&#44; GH&#44; and MRH contributed to the writing of the second and third drafts&#46; JS&#44; MRH&#44; and RH provided comments on initial drafts and coordinated the final draft&#46; All authors read and approved the final manuscript&#46; All authors take responsibility for the integrity of the data and the accuracy of the data analysis&#46;</p></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0175">Funding</span><p id="par0150" class="elsevierStylePara elsevierViewall">Thanks to financial support&#44; guidance&#44; and advice from the &#8220;<span class="elsevierStyleGrantSponsor" id="gs1">Rafsanjan University of Medical Sciences</span>&#8221;&#46;</p></span><span id="sec0105" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0180">Conflicts of interest</span><p id="par0155" class="elsevierStylePara elsevierViewall">The authors of this study declare no conflict of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:18 [
        0 => array:3 [
          "identificador" => "xres1937894"
          "titulo" => "Abstract"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Aims"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            4 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1669985"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "xpalclavsec1669987"
          "titulo" => "Abbreviations"
        ]
        3 => array:3 [
          "identificador" => "xres1937893"
          "titulo" => "Resumen"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Antecedentes"
            ]
            1 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Objetivo"
            ]
            2 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "M&#233;todos"
            ]
            3 => array:2 [
              "identificador" => "abst0045"
              "titulo" => "Resultados"
            ]
            4 => array:2 [
              "identificador" => "abst0050"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "xpalclavsec1669986"
          "titulo" => "Palabras clave"
        ]
        5 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        6 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:8 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Study setting and participants"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Inclusion and exclusion criteria for case group"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Inclusion and exclusion criteria for control group"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Samples size"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Collecting data"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Experimental procedure"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Statistical analysis"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Ethical considerations"
            ]
          ]
        ]
        7 => array:3 [
          "identificador" => "sec0055"
          "titulo" => "Results"
          "secciones" => array:2 [
            0 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Demographic and epidemiological characteristics"
            ]
            1 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Experimental findings"
            ]
          ]
        ]
        8 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Discussion"
        ]
        9 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Conclusion"
        ]
        10 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Availability of data and materials"
        ]
        11 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Ethics approval and consent to participate"
        ]
        12 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Consent for publication"
        ]
        13 => array:2 [
          "identificador" => "sec0095"
          "titulo" => "Authors&#8217; contributions"
        ]
        14 => array:2 [
          "identificador" => "sec0100"
          "titulo" => "Funding"
        ]
        15 => array:2 [
          "identificador" => "sec0105"
          "titulo" => "Conflicts of interest"
        ]
        16 => array:2 [
          "identificador" => "xack679034"
          "titulo" => "Acknowledgment"
        ]
        17 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-07-21"
    "fechaAceptado" => "2022-12-29"
    "PalabrasClave" => array:2 [
      "en" => array:2 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1669985"
          "palabras" => array:5 [
            0 => "DNA methyltransferase"
            1 => "Epigenetic"
            2 => "Histone deacetylase 1"
            3 => "Systemic lupus erythematosus"
            4 => "Iran"
          ]
        ]
        1 => array:4 [
          "clase" => "abr"
          "titulo" => "Abbreviations"
          "identificador" => "xpalclavsec1669987"
          "palabras" => array:12 [
            0 => "SLE"
            1 => "DNMT"
            2 => "HDAC1"
            3 => "ESR"
            4 => "CRP"
            5 => "RF"
            6 => "ANTI CCP"