array:22 [
  "pii" => "S1699258X24000792"
  "issn" => "1699258X"
  "doi" => "10.1016/j.reuma.2024.07.001"
  "estado" => "S300"
  "fechaPublicacion" => "2024-11-01"
  "aid" => "1779"
  "copyrightAnyo" => "2024"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Reumatol Clin. 2024;20:470-5"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S1699258X24000809"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2024.07.002"
    "estado" => "S300"
    "fechaPublicacion" => "2024-11-01"
    "aid" => "1780"
    "copyright" => "Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Reumatol Clin. 2024;20:476-83"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "A detailed quantitative analysis of circulating T peripheral and follicular helper lymphocytes in patients with rheumatoid arthritis and systemic lupus erythematosus"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "476"
          "paginaFinal" => "483"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "An&#225;lisis cuantitativo detallado de linfocitos T de ayuda perif&#233;ricos y foliculares en pacientes con artritis reumatoide y lupus eritematoso generalizado"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0020"
          "etiqueta" => "Fig&#46; 4"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr4.jpeg"
              "Alto" => 2000
              "Ancho" => 2824
              "Tamanyo" => 514796
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Quantitative analysis of circulating plasmablasts in patients with RA and SLE&#46; &#40;A&#41; Flow cytometry strategy for the analysis of circulating plasmablast&#46; PBMC were stained with the indicated mAbs and analyzed by flow cytometry&#44; as stated in &#8220;Materials and methods&#8221; section&#46; Cells with the phenotype CD19<span class="elsevierStyleSup">&#43;</span>CD27<span class="elsevierStyleSup">&#43;</span>CD20<span class="elsevierStyleSup">&#8722;</span>CD38<span class="elsevierStyleSup">hi</span> were considered as plasmablasts&#46; &#40;B and C&#41; Percent and absolute number of plasmablasts in samples from patients with RA and SLE and healthy controls&#46; Data correspond to the median and <span class="elsevierStyleItalic">Q</span><span class="elsevierStyleInf">1</span>&#8211;<span class="elsevierStyleItalic">Q</span><span class="elsevierStyleInf">3</span> interquartile range&#46; &#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#59; &#42;&#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Raquel S&#225;nchez-Guti&#233;rrez, Marlen Vitales-Noyola, Larisa Gonz&#225;lez-Baranda, Diana P&#46; Portales-P&#233;rez, Esther Layseca-Espinosa, Mariana H&#46; Garc&#237;a-Hern&#225;ndez, Roberto Gonz&#225;lez-Amaro"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Raquel"
              "apellidos" => "S&#225;nchez-Guti&#233;rrez"
            ]
            1 => array:2 [
              "nombre" => "Marlen"
              "apellidos" => "Vitales-Noyola"
            ]
            2 => array:2 [
              "nombre" => "Larisa"
              "apellidos" => "Gonz&#225;lez-Baranda"
            ]
            3 => array:2 [
              "nombre" => "Diana P&#46;"
              "apellidos" => "Portales-P&#233;rez"
            ]
            4 => array:2 [
              "nombre" => "Esther"
              "apellidos" => "Layseca-Espinosa"
            ]
            5 => array:2 [
              "nombre" => "Mariana H&#46;"
              "apellidos" => "Garc&#237;a-Hern&#225;ndez"
            ]
            6 => array:2 [
              "nombre" => "Roberto"
              "apellidos" => "Gonz&#225;lez-Amaro"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X24000809?idApp=UINPBA00004M"
    "url" => "/1699258X/0000002000000009/v1_202411050519/S1699258X24000809/v1_202411050519/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1699258X24000883"
    "issn" => "1699258X"
    "doi" => "10.1016/j.reuma.2024.07.006"
    "estado" => "S300"
    "fechaPublicacion" => "2024-11-01"
    "aid" => "1788"
    "copyright" => "Elsevier Espa&#241;a&#44; S&#46;L&#46;U&#46; and Sociedad Espa&#241;ola de Reumatolog&#237;a y Colegio Mexicano de Reumatolog&#237;a"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Reumatol Clin. 2024;20:463-9"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "Evaluaci&#243;n de la eficacia y seguridad de la terapia gravitacional en una cohorte de pacientes con esclerosis sist&#233;mica"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "463"
          "paginaFinal" => "469"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "Evaluation of the efficacy and safety of gravitational therapy in a cohort of patients with systemic sclerosis"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0015"
          "etiqueta" => "Figura 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 868
              "Ancho" => 1030
              "Tamanyo" => 29556
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Comparaci&#243;n entre el puntaje de Rodnan modificado &#40;mRSS&#41; pretratamiento y su variaci&#243;n&#46; Se observa una correlaci&#243;n significativa entre la magnitud de la reducci&#243;n del mRSS &#40;post-TG - pre-TG&#41; y el valor inicial pre-TG &#40;R<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#44;84&#44; p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;05&#41;&#46; La reducci&#243;n del mRSS fue mayor en los pacientes con mRSS iniciales m&#225;s altos&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Luisa Fernanda Servioli, Eugenia Isasi, Alejandra P&#233;rez, Silvia Pouquette, Mar&#237;a Elo&#237;sa Isasi"
          "autores" => array:5 [
            0 => array:2 [
              "nombre" => "Luisa Fernanda"
              "apellidos" => "Servioli"
            ]
            1 => array:2 [
              "nombre" => "Eugenia"
              "apellidos" => "Isasi"
            ]
            2 => array:2 [
              "nombre" => "Alejandra"
              "apellidos" => "P&#233;rez"
            ]
            3 => array:2 [
              "nombre" => "Silvia"
              "apellidos" => "Pouquette"
            ]
            4 => array:2 [
              "nombre" => "Mar&#237;a Elo&#237;sa"
              "apellidos" => "Isasi"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2173574324001370"
        "doi" => "10.1016/j.reumae.2024.10.004"
        "estado" => "S200"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173574324001370?idApp=UINPBA00004M"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X24000883?idApp=UINPBA00004M"
    "url" => "/1699258X/0000002000000009/v1_202411050519/S1699258X24000883/v1_202411050519/es/main.assets"
  ]
  "en" => array:21 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "HLA-B&#42;51&#58;01 in Iranian patients with Behcet uveitis syndrome"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "470"
        "paginaFinal" => "475"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Zahra Hoseini, Fatemeh Rezaei Rad, Mohammad Zarei, Nazanin Ebrahimiadib, Zahra Salimian, Mahdi Zamani"
        "autores" => array:6 [
          0 => array:3 [
            "nombre" => "Zahra"
            "apellidos" => "Hoseini"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Fatemeh Rezaei"
            "apellidos" => "Rad"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Mohammad"
            "apellidos" => "Zarei"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Nazanin"
            "apellidos" => "Ebrahimiadib"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Zahra"
            "apellidos" => "Salimian"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          5 => array:4 [
            "nombre" => "Mahdi"
            "apellidos" => "Zamani"
            "email" => array:1 [
              0 => "mzamani@tums.ac.ir"
            ]
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#9674;</span>"
                "identificador" => "fn0005"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:3 [
          0 => array:3 [
            "entidad" => "Department of Medical Genetics&#44; School of Medicine&#44; Tehran University of Medical Sciences&#44; Tehran&#44; Iran"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Farabi Eye Hospital&#44; Tehran University of Medical Sciences&#44; Tehran&#44; Iran"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Ophthalmology&#44; University of Florida&#44; Gainesville&#44; FL&#44; USA"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "HLA B51 en pacientes iran&#237;es con uve&#237;tis en contexto de s&#237;ndrome de Beh&#231;et"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 956
            "Ancho" => 1025
            "Tamanyo" => 208935
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Sequence of HLA-B&#42;51&#58;01 allele&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Behcet&#39;s disease &#40;BD&#41; is a rare systemic vasculitis disorder with an unknown etiology&#46; BD can manifest globally but is more frequent in the region along the Silk Road&#44; including Mediterranean&#44; Middle Eastern and Far Eastern countries&#46;<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">1</span></a> This disease has the highest prevalence in Turkey&#44; from 20 to 420&#44; and then in Iran&#44; from 80 to 100 per 100&#44;000 inhabitants&#46;<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">2</span></a> Although any organ can get involved&#44; it is specially characterized by oral and genital ulcers&#44; ocular inflammatory involvement&#44; skin lesions&#44; and vascular involvement&#46;<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">3</span></a> Inflammation of the middle layer of the eye &#40;uveitis&#41; is a major involvement site and an important cause of disability in BD&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">4</span></a> The most widely used system to classify the eye involvement in uveitis is based on the primary anatomical location of the inflammation&#44; and was originally established by the International Uveitis Study Group &#40;IUSG&#41;&#46; It divides uveitis into four anatomical categories&#58; anterior uveitis&#44; intermediate uveitis&#44; posterior uveitis and panuveitis&#46;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">5</span></a> The Behcet&#39;s uveitis &#40;BU&#41; is most commonly characterized by a chronic panuveitis or posterior uveitis with occlusive retinal vasculitis&#46; Without appropriate and timely treatment&#44; Behcet&#39;s uveitis is a progressive blinding disease&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">6</span></a> Although the etiology and pathogenesis of BD is not fully elucidated&#44; it is believed to be triggered by environmental factors in individuals with certain genetic backgrounds&#46; Familial aggregation of BD also supports the involvement of genetic factors in its pathogenesis&#46; No Mendelian inheritance pattern has been described in BD&#46; Several studies have shown that immune abnormalities may underlie the development of BD&#46; It is hypothesized that BD pathogenesis is an aberrant inflammatory response initiated by infectious agents or autoantigens in patients with predisposing genetic factors and both innate and acquired immunity pathways are involved&#46; The immunopathogenesis of Behcet&#39;s uveitis concerning maturation markers of dendritic cells&#44; intraocular effector cell profiles&#44; and the cytokine&#47;chemokine environment is different from other autoimmune uveitis&#46;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">7</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">The HLA &#40;human leukocyte antigen&#41; complex located on a 4 Mbp stretch within chromosome 6P21&#46;3 consists of more than 200 genes&#46;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">8</span></a> These molecules are divided into three classes&#46; HLA class I molecules are composed of a heavy and light chain&#46; The heavy chain is encoded by the polymorphic HLA locus and the light chain is an invariant protein of &#946;2-microglobulin &#40;&#946;2m&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">9</span></a> HLA-I molecules are expressed at the cell membrane and play a critical role in the immune response by presenting the loaded peptides to CD8&#43; T cells and interacting with natural killer &#40;NK&#41; cells&#46; Bearing in mind the role of HLA genes in the inflammatory response of the immune system and the occurrence of these responses in Behcet&#39;s disease&#44; these genes are considered candidate genes for BD&#46;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">10</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">Several studies to date have shown the contribution of specific HLA genes in BD pathogenesis&#46; For example&#44; the BD susceptibility has been proposed to be associated with the HLA class I-B&#42;51 allele&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">11</span></a> A study conducted in a Turkish population showed that HLA-B51 was significantly increased in BD patients compared to the controls&#46;<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">12</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">In another study conducted in the Korean population&#44; the increase of HLA-B&#42;51 allele in Behcet&#39;s patients was confirmed&#44; and furthermore showed that the frequency of HLA-B&#42;51 allele in the patients with symptoms of uveitis was statistically significant&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">13</span></a> Currently&#44; the strongest risk factor for Behcet&#39;s disease&#44; especially with eye symptoms&#44; is the aberrant expression of the HLA-B&#42;51 allele&#46; This gene may contribute to BD pathogenesis by several different mechanisms&#44; involving both adaptive &#40;by the presentation of certain pathogenic peptides to CD8 T cells&#41; and innate &#40;by interacting with natural killer cell receptors and activating intracellular inflammatory pathways associated with heavy chain folding problems and endoplasmic reticulum stress&#41; immune responses&#46;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">14</span></a> Identification of endoplasmic reticulum aminopeptidase 1 &#40;ERAP1&#41; polymorphisms as a recessively inherited risk factor only in people carrying HLA-B&#42;51 allele manifested the significant role of peptides loaded onto the antigen-binding groove of HLA-B&#42;51&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">15</span></a> Among more than 250 subtypes of HLA-B&#42;51 identified by protein sequencing&#44; HLA-B&#42;51&#58;01 allele subtype has been most associated with BD in several populations&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">16</span></a> In this regard&#44; a study was performed in the Greek population in which a significant number of the BD patients were carriers of the B&#42;51&#58;01 allele&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">17</span></a> Investigation of the linkage between BD and other HLA-B alleles revealed a weak correlation between the HLA-B&#42;27 allele and this condition&#46; One study has shown a significant association between Behcet&#39;s uveitis and HLA-B&#42;27 in the Korean populations&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">18</span></a> This discrepancy could be due to the sensitivity of the methodologies employed&#44; hence a study with valid and modern methods needs to be conducted on the genetic relationship between Behcet&#39;s uveitis and HLA gene alleles&#46; In this study&#44; for the first time&#44; with high resolution and at the molecular levels&#44; we have investigated the association of Bechet&#39;s uveitis with HLA-B&#42;51&#58;01&#47;x and HLA-B&#42;27&#47;x genotypes&#44; in Iranian population&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Patients and controls</span><p id="par0025" class="elsevierStylePara elsevierViewall">Blood samples from 50 unrelated Iranian patients with Behcet&#39;s uveitis from the Uveitis Clinic of Farabi Eye Hospital were collected&#46; It should be noted that due to the very low frequency of Behcet&#39;s uveitis in the population&#44; it was not possible to collect more specimens&#46; The diagnosis of BD was based on International Criteria for Behcet Disease and all patient were examined and evaluated by one ophthalmologist expert in the field of uveitis &#40;MZ or NE&#41;&#46; In addition to complete eye examination&#44; supplementary paraclinical investigations including fluorescein angiography &#40;FA&#41; and macular optical coherence tomography &#40;OCT&#41; were done&#46; Also&#44; 70 healthy people over 40 years of age who had no history of Behcet&#39;s disease and other similar diseases were selected as controls&#46; The age in control group was over 40 years&#59; thus&#44; the chance of future development of BD in this group deemed to be low&#46; These patient and control groups had the same geographical origin&#46; In the patient group&#44; information regarding the anatomic subtype of uveitis &#40;including anterior&#44; intermediate&#44; posterior&#44; panuveitis&#41;&#44; family history of BD&#44; family history of other inflammatory eye diseases and history of non-ocular inflammatory diseases were collected&#46; After obtaining consent from the patient&#44; or their legal guardians and control groups&#44; questionnaire forms were prepared and information was collected&#46; This study was authorized by the ethics committee and review board of the Tehran University of Medical Sciences&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Statistical analysis</span><p id="par0030" class="elsevierStylePara elsevierViewall">All clinical and genotyping data of the HLA-B&#42;51&#58;01&#47;x&#44; HLA-B&#42;27&#47;x allelic marker genes&#44; were recorded into a database and analyzed with SPSS&#44; version 26 for Windows &#40;Chicago&#44; IL&#44; USA&#41;&#46; Fisher&#39;s exact test and relative risk were used for comparing the frequencies of studied genotypes between the Behcet patients and control group&#46; Fisher exact tests were utilized for statistical analysis of results&#44; and <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 is presumed to be statistically meaningful&#46; Besides&#44; positive predictive value &#40;PPV&#41; figures&#44; the efficiency of a diagnostic test and represents the likelihood for a person with a positive test of having or developing the disease&#46; In this case-control study&#44; the subsequent formula was employed to characterize prevalence-corrected positive predictive value &#40;PcPPV&#41;&#58;<elsevierMultimedia ident="eq0005"></elsevierMultimedia>where <span class="elsevierStyleItalic">P</span><span class="elsevierStyleInf"><span class="elsevierStyleItalic">D</span></span> is the frequency of the disease in the whole population&#44; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleInf"><span class="elsevierStyleItalic">DT</span>&#43;</span> is the ratio of patients with a positive test and <span class="elsevierStyleItalic">P</span><span class="elsevierStyleInf"><span class="elsevierStyleItalic">CT</span>&#43;</span> is the ratio of control group with a positive test&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">19</span></a></p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">HLA allele typing and amino acid polymorphism analyses</span><p id="par0035" class="elsevierStylePara elsevierViewall">About 5<span class="elsevierStyleHsp" style=""></span>ml of blood was collected from the patient and control group in vials containing EDTA and DNA extraction from whole blood was done in less than a week by a modified salting-out extraction method&#46; Sequence-specific primers &#40;SSP&#41; were applied to characterize HLA-B&#42;51&#58;01 and HLA-B&#42;27 alleles&#46; To determine the B51 allele&#44; at first&#44; this allele was typed together with the B52 allele using SSP method&#44; then the B52 allele was typed alone&#44; the remaining alleles were B51&#44; and the B51 types were the B5101 allele at the resolution levels&#46; Oligo 7 software was used for primer design and gene sequences were obtained from NCBI&#46; Sequence of designed primers is shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46; PCR-SSP profile for amplification of HLA-B&#42;51&#58;01 and HLA-B&#42;27 was 60<span class="elsevierStyleHsp" style=""></span>s at 96<span class="elsevierStyleHsp" style=""></span>&#176;C for denaturation&#59; five cycles of denaturation at 96<span class="elsevierStyleHsp" style=""></span>&#176;C for 20<span class="elsevierStyleHsp" style=""></span>s&#44; annealing at 70<span class="elsevierStyleHsp" style=""></span>&#176;C for 45<span class="elsevierStyleHsp" style=""></span>s and extension at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 25<span class="elsevierStyleHsp" style=""></span>s&#59; 25 cycles of denaturation at 96<span class="elsevierStyleHsp" style=""></span>&#176;C for 20<span class="elsevierStyleHsp" style=""></span>s&#44; annealing at 65<span class="elsevierStyleHsp" style=""></span>&#176;C for 50<span class="elsevierStyleHsp" style=""></span>s and extension at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#59; and 5 cycles of denaturation at 96<span class="elsevierStyleHsp" style=""></span>&#176;C for 20<span class="elsevierStyleHsp" style=""></span>s&#44; annealing at 55<span class="elsevierStyleHsp" style=""></span>&#176;C for 60<span class="elsevierStyleHsp" style=""></span>s and extension at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 120<span class="elsevierStyleHsp" style=""></span>s&#46;<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">20</span></a> Then the PCR products were electrophoresed on 6&#37; polyacrylamide gels and application of a 50-bp DNA ladder&#46; PCR bands became visible by ethidium bromide staining and the correct size of each specific allele was determined by using the running DNA ladder&#46; Some examples of HLA-B&#42;51&#58;01 and HLA-B&#42;27 locus-specific typing results are manifested in <a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#46; Also&#44; in order to ensure accurate detection of the B&#42;51&#58;01 allele sequence&#44; the sequence of this allele in one of the patient&#39;s samples was determined by Sanger sequencing technique&#44; as shown in <a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Results</span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">The effect of B&#42;51&#58;01&#47;x and B&#42;27&#47;x genotypes on Behcet&#39;s uveitis protection or susceptibility</span><p id="par0040" class="elsevierStylePara elsevierViewall">The results of the distribution of types of uveitis in this study show that 29 patients had posterior uveitis and 21 patients had panuveitis&#46; 93&#37; of posterior uveitis patients and 66&#37; of panuveitis patients had the B&#42;51&#58;01&#47;x genotype &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0045" class="elsevierStylePara elsevierViewall">Moreover&#44; the results of gender distribution show that men constitute 86&#37; and women constitute 14&#37; of Behcet&#39;s uveitis patients in the study&#46; 74&#37; of Behcet&#39;s uveitis patients in this study are in the age range of 20&#8211;40 years&#46; Also&#44; the average age of the patients was 38&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">The distribution of B&#42;51&#58;01&#47;x and B&#42;27&#47;x genotype frequencies in the total patients and healthy controls is summarized in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; As compared with controls&#44; statistical analysis of the B&#42;27&#47;x genotype demonstrates that there is no significant association between this genotype and total Behcet&#39;s uveitis in Iranian patients &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#44; RR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;4&#41; in contrast to B&#42;27&#47;x&#44; the results showed that the frequency of B&#42;51&#58;01&#47;x genotype was significantly higher in total Behcet&#39;s uveitis patients &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#44; RR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;76&#41; when compared to the controls&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Clinical importance of testing for the B&#42;51&#58;01&#47;x and B&#42;27&#47;x genotypes</span><p id="par0055" class="elsevierStylePara elsevierViewall">In case-control studies&#44; relative risk &#40;RR or OR&#41; is generally utilized to predict the risk of specific alleles and genotypes&#46; Since this method does not consider the prevalence of the disease in the general population&#44; it does not provide a true risk assessment&#46; On the other hand&#44; prevalence-corrected positive predictive values &#40;PcPPV&#41; predict the absolute risk based on the prevalence of the disease in the general population&#46; The PcPPV of testing for B&#42;51&#58;01&#47;x and B&#42;27&#47;x genotypes were measured for Behcet&#39;s uveitis&#46; The prevalence of Behcet&#39;s uveitis for estimating the predictive values was taken as 0&#46;04&#37; based on the studies in the Iranian population&#46;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">21</span></a></p><p id="par0060" class="elsevierStylePara elsevierViewall">The PcPPV of testing for the HLA-B&#42;27&#47;x genotype&#44; which indicated no significant association with Behcet&#39;s uveitis&#44; was 0&#46;05&#37; for total Behcet&#39;s uveitis patients &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46; This demonstrates that individuals who are carrying the HLA-B&#42;27&#47;x genotype have a 0&#46;05&#37; absolute risk to develop Behcet&#39;s uveitis&#46; HLA-B&#42;51&#58;01&#47;x genotype with a probability of 0&#46;065&#37; had high PcPPV value for the development of Behcet&#39;s uveitis&#46; This high PcPPV value indicates that in the presence of clinical symptoms&#44; carriers of this allele have a high risk for developing Behcet&#39;s uveitis compared to the normal population &#40;0&#46;04&#37;&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Discussion</span><p id="par0065" class="elsevierStylePara elsevierViewall">Beh&#231;et&#39;s disease is a chronic&#44; recurrent multisystem inflammatory disorder characterized by genital and oral ulcers&#44; skin lesions&#44; arthritis&#44; and involvement of the vascular&#44; neurological&#44; and gastrointestinal systems&#44; as well as inflammation of the middle layer of the eye&#44; known as uveitis&#46; Behcet&#39;s uveitis is one of the important complications of BD&#44; which can even lead to complete blindness&#46;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">22</span></a> Uveitis can be classified as anterior&#44; intermediate&#44; posterior&#44; or panuveitis based on the location of the inflammation&#46; Anterior uveitis affects the front part of the eye&#44; intermediate uveitis impacts the vitreous and peripheral retina&#44; posterior uveitis involves the choroid and retina&#44; and panuveitis affects all layers of the uveal tract&#46;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">5</span></a> The etiology of BD is unclear&#44; however Microbial stimuli&#44; environmental factors&#44; endothelial dysfunction&#44; genetic predisposition and immunological disorders is involved in pathogenesis of this disorder&#46; Several evidences suggest that specific genetic backgrounds along with environmental factors play a role in BD development&#46;<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">23</span></a></p><p id="par0070" class="elsevierStylePara elsevierViewall">In this study&#44; we have examined the association of two HLA alleles with Beh&#231;et&#39;s uveitis&#44; focusing on anterior and panuveitis&#44; which are both common in Beh&#231;et&#39;s syndrome&#46; Several studies have shown that immune abnormalities may underlie the development of BD&#46; It is hypothesized that the pathogenesis of BD begins with an inflammatory response against infectious agents or autoantigens in genetically predisposed patients and is sustained by innate and acquired immunity&#46;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">24</span></a> Moreover&#44; a set of immune mediators such as the products of HLA type I gene complex perform a great role in the inflammatory cascade&#46; However&#44; studies to date have not been able to demonstrate a clear role for specific HLA genes in an inflammation induced BD pathogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">25</span></a></p><p id="par0075" class="elsevierStylePara elsevierViewall">In this study&#44; the role of B&#42;51&#58;01&#47;x and B&#42;27&#47;x genotypes in Iranian patients with Behcet&#39;s uveitis has been investigated&#46; We chose to compare Behcet&#39;s uveitis patients with a healthy population rather than Behcet&#39;s patients without uveitis&#44; as the latter group may develop uveitis in the future&#44; complicating the study&#46; This approach also allowed us to investigate whether uveitis in Behcet&#39;s patients has an autoimmune basis similar to Behcet&#39;s disease&#46; Genetic studies suggest that diseases such as Behcet&#39;s uveitis and inclusion spondylitis&#44; share the same HLA-B27 risk factor&#44; which is likely involved in ocular immune regulation&#46;<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">26</span></a> In addition&#44; B27 causes the accumulation of fibrin and the inflammatory cells and expansion of the hypopyon in the anterior chamber of the eye&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">27</span></a> Despite these indications&#44; the findings of this study demonstrates that B&#42;27&#47;x genotype is not linked to Behcet&#39;s uveitis&#46; In line with our findings&#44; in a serological study in Iran&#44; the authors could not show any significant association between the B&#42;27&#47;x genotype and Behcet&#39;s uveitis&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">28</span></a> But these findings are contrary to previous study in 98 patients with Behcet&#39;s uveitis of the Korean population&#44; which confirmed the predisposing role of the B&#42;27&#47;x genotype in Behcet&#39;s uveitis&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">18</span></a> This discrepancy may be attributed to the demographic and genetic differences between the two populations&#46; Also&#44; our findings indicate a highly significant difference in HLA-B&#42;51&#58;01&#47;x genotype frequencies between Behcet&#39;s uveitis patients and controls &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#41;&#44; highlighting its strong susceptibility in the Iranian population and its association with more severe forms of uveitis&#44; particularly panuveitis&#44; leading to a poorer visual prognosis&#46; Several studies to date have shown the contribution of HLA-B&#42;51&#58;01&#47;x genotype in Behcet&#39;s uveitis pathogenesis&#46; In one study conducted in the Korean population&#44; the increased involvement of HLA-B&#42;51 allele in Behcet&#39;s patients was confirmed&#46; Also&#44; in the same study it was found that the frequency of HLA-B&#42;51 in the patients with symptoms of uveitis was statistically significant&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">13</span></a></p><p id="par0080" class="elsevierStylePara elsevierViewall">The results of gender distribution show that men constitute 86&#37; and women constitute 14&#37; of Behcet&#39;s uveitis patients in the study&#46; Therefore&#44; the frequency of this condition in the Iranian male population was about 6 times higher than that of the females&#46;</p><p id="par0085" class="elsevierStylePara elsevierViewall">In case&#8211;control studies&#44; odds ratios or relative risks can be used to measure the risks&#44; but real-lifetime risk or absolute risk cannot be estimated&#46; The test efficiency for specific allele or genotype can be assessed by way of PcPPV formula&#46; To calculate the absolute risk by PcPPV in any population&#44; the lifetime prevalence of the disorder in the target population is required&#59; the Behcet&#39;s uveitis prevalence in Iranian population is 0&#46;04&#37;&#46; The PcPPV of testing for B&#42;27&#47;x genotype&#44; that presented no significant association with Behcet&#39;s uveitis was 0&#46;05&#37; for all BU patients&#46; This indicates that individuals who are carrying the B&#42;27&#47;x genotype show 0&#46;05&#37; absolute risk to develop Behcet&#39;s uveitis which is not much different from the normal population&#46; The highest PcPPV was presented for B&#42;51&#58;01&#47;x genotype in BU disorder and that was 0&#46;065&#37; for Iranian peoples&#46; Such a high PcPPV value means that in the presence of clinical symptoms&#44; as compared to the general population &#40;0&#46;04&#37;&#41;&#44; carriers of this allele have a high risk for developing BU&#46; These results&#44; therefore&#44; strengthen the susceptibility role of B&#42;51&#58;01&#47;x genotype in the development of Behcet&#39;s uveitis in the Iranian population&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">Differences in racial backgrounds and the diverse nature of BD can partially explain the observed discrepancies between our results and data collected from other regions of the world&#46; According to several studies&#44; it can be concluded that the continuous and progressive aberrant inflammatory response caused by the activation of HLA genes can be effective in the pathogenesis of Behcet&#39;s disease&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">It has been suggested that changed peptide binding groove in HLA-B&#42;51 impacts on biology of cells and immune function&#46;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">29</span></a> Indeed&#44; polymorphisms of HLA-B&#42;51 at positions 67&#44; 97&#44; 116 and152 influence on the development of BD&#46; These four residues determine the shapes and sizes antigen binding groove of HLA-B molecule&#46;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">30</span></a></p><p id="par0100" class="elsevierStylePara elsevierViewall">On the other hand&#44; as mentioned&#44; aberrant interactions of the improperly structured HLA-B&#42;51 with NK cells could also be an attractive explanation for the occurrence of the disease process&#46;<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">31</span></a> Studies have shown that HLA-B&#42;51 interacts through its Bw4 epitope with the inhibitory killer immunoglobulin-like receptor &#40;KIR&#41;&#44; KIR3DL&#44; located on NK cells&#46;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">32</span></a> The improper interactions between the abnormal HLA-B&#42;51 and the NK cells can result in alterations in NK cell activity and induction of the pathogenesis of BD in two possible ways&#59; 1&#46; NK cells without appropriate performance of inhibitory KIR may fail to distinguish self-MHC and induce autologous tissue damage&#59; 2&#46; Drawbacks in the NK cell repertoire may cause persistent viral infections which leads to a chronic inflammatory response in BD&#46;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">33</span></a> An enhanced understanding of the association between HLA-B&#42;51 and BD may lead to proper therapeutic approaches&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Conclusion</span><p id="par0105" class="elsevierStylePara elsevierViewall">In summary&#44; our findings indicate that the B&#42;27&#47;x genotype has no significant association with Behcet&#39;s uveitis&#44; while&#44; B&#42;51&#58;01&#47;x genotype imposes strong susceptibility for Behcet&#39;s uveitis&#46; We also have suggested that the role of B&#42;51&#58;01 in the pathogenesis of Behcet&#39;s uveitis is probably due to the presence of improper amino acids in its antigen binding groove and the abnormal interactions of such variations of this allele with NK cells&#46; Additional studies are required to display the accurate role of HLA genes and their potential association with other influential factors in pathogenesis of Behcet&#39;s uveitis&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Ethics approval</span><p id="par0110" class="elsevierStylePara elsevierViewall">Approval was granted by the ethics committee and the review board of Tehran University of Medical Sciences &#91;49530&#93;&#46;</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Funding</span><p id="par0115" class="elsevierStylePara elsevierViewall">This study was supported by a research grant from <span class="elsevierStyleGrantSponsor" id="gs1">Tehran University of Medical Sciences</span>&#46;</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Authors&#8217; contributions</span><p id="par0120" class="elsevierStylePara elsevierViewall">Zahra Hoseini&#58; Conceptualization&#44; Methodology&#44; Formal analysis&#44; Writing &#8211; original draft&#44; Visualization&#46; Fatemeh Rezaei Rad&#58; Writing &#8211; review &#38; editing&#44; Software&#44; Form analysis&#46; Mohammad Zarei&#58; Conceptualization&#44; Methodology&#44; Software&#44; Form analysis&#44; Resources&#44; Writing&#46; Nazanin Ebrahimiadib&#58; Writing &#8211; review &#38; editing&#46; Zahra Salimian Rizi&#58; Writing &#8211; review &#38; editing&#46; Mahdi Zamani&#58; Conceptualization&#44; Methodology&#44; Resources&#44; Investigation&#44; Writing &#8211; review &#38;editing&#44; Supervision&#44; Project administration&#44; Funding acquisition&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Research involving human participants and informed consent</span><p id="par0125" class="elsevierStylePara elsevierViewall">Questionnaire forms were prepared for each patient and control individuals&#46; Before being included in the study&#44; informed consent was taken from all the patients&#44; or their legal guardians and control subjects&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Conflict of interest</span><p id="par0130" class="elsevierStylePara elsevierViewall">The authors have no conflicts of interest&#44; relevant to the content of this article to declare&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Availability of data and material</span><p id="par0135" class="elsevierStylePara elsevierViewall">Not applicable&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Code availability</span><p id="par0140" class="elsevierStylePara elsevierViewall">Not applicable&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:18 [
        0 => array:3 [
          "identificador" => "xres2292722"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1905362"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres2292721"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Antecedentes"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1905361"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Patients and controls"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Statistical analysis"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "HLA allele typing and amino acid polymorphism analyses"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0030"
          "titulo" => "Results"
          "secciones" => array:2 [
            0 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "The effect of B&#42;51&#58;01&#47;x and B&#42;27&#47;x genotypes on Behcet&#39;s uveitis protection or susceptibility"
            ]
            1 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Clinical importance of testing for the B&#42;51&#58;01&#47;x and B&#42;27&#47;x genotypes"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0045"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "sec0050"
          "titulo" => "Conclusion"
        ]
        9 => array:2 [
          "identificador" => "sec0055"
          "titulo" => "Ethics approval"
        ]
        10 => array:2 [
          "identificador" => "sec0060"
          "titulo" => "Funding"
        ]
        11 => array:2 [
          "identificador" => "sec0065"
          "titulo" => "Authors&#8217; contributions"
        ]
        12 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Research involving human participants and informed consent"
        ]
        13 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Conflict of interest"
        ]
        14 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Availability of data and material"
        ]
        15 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Code availability"
        ]
        16 => array:2 [
          "identificador" => "xack786944"
          "titulo" => "Acknowledgments"
        ]
        17 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2024-01-18"
    "fechaAceptado" => "2024-07-02"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1905362"
          "palabras" => array:3 [
            0 => "Behcet&#39;s uveitis"
            1 => "HLA genes"
            2 => "PCR&#46;"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1905361"
          "palabras" => array:3 [
            0 => "Uve&#237;tis de Beh&#231;et"
            1 => "Genes HLA"
            2 => "PCR"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Behcet&#39;s disease &#40;BD&#41; is a multisystem disorder prevalent along the historic Silk Road&#44; with Behcet&#39;s uveitis &#40;BU&#41; representing a significant complication contributing to disability&#46; Various studies have linked different HLA alleles with BD across diverse populations&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">In this study&#44; we investigated the association between HLA-B51&#58;01&#47;x and HLA-B27&#47;x genotypes with Behcet&#39;s uveitis in 50 unrelated Iranian patients diagnosed with Behcet&#39;s uveitis&#44; comparing them to a control group of 70 healthy individuals&#46; Our analysis aimed to determine the susceptibility conferred by these alleles and assess their clinical relevance&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Our findings indicate a notable susceptibility conferred by the HLA-B51&#58;01&#47;x genotype for Behcet&#39;s uveitis &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#41;&#46; Conversely&#44; the B27&#47;x genotype did not demonstrate significant associations with Behcet&#39;s uveitis&#46; Furthermore&#44; we employed prevalence-corrected positive predictive value &#40;PcPPV&#41; calculations to gauge the clinical utility of testing for these alleles within the Iranian Behcet&#39;s uveitis patient population&#46; The PcPPV for B27&#47;x genotype testing was determined to be 0&#46;05&#37;&#44; while the PcPPV for B51&#58;01&#47;x genotype testing in the same population was 0&#46;065&#37;&#46; These results suggest that carriers of the B&#42;51&#58;01 allele&#44; when presenting with clinical symptoms&#44; exhibit a heightened risk for Behcet&#39;s uveitis compared to the general population&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Individuals carrying the B51&#58;01 allele&#44; when symptomatic&#44; face an elevated Behcet&#39;s uveitis risk&#46; This insight aids in targeted clinical assessments for at-risk populations&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Antecedentes</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">El s&#237;ndrome de Beh&#231;et es un trastorno multisist&#233;mico que prevalece a lo largo de la hist&#243;rica Ruta de la Seda&#44; y la uve&#237;tis de Beh&#231;et representa una complicaci&#243;n importante que contribuye a la discapacidad&#46; Varios estudios han relacionado diferentes alelos HLA con BD en diversas poblaciones&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">M&#233;todos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">En este estudio&#44; investigamos la asociaci&#243;n entre los genotipos HLA-B51&#58;01&#47;x y HLA-B27&#47;x con la uve&#237;tis de Beh&#231;et en 50 pacientes iran&#237;es no relacionados con diagn&#243;stico de uve&#237;tis de Beh&#231;et&#44; compar&#225;ndolos con un grupo de control de 70 individuos sanos&#46; Nuestro an&#225;lisis tuvo como objetivo determinar la susceptibilidad que confieren estos alelos y evaluar su relevancia cl&#237;nica&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Nuestros hallazgos indican una notable susceptibilidad conferida por el genotipo HLA-B51&#58;01&#47;x para la uve&#237;tis de Beh&#231;et &#40;p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#44;0001&#41;&#46; Por el contrario&#44; el genotipo B27&#47;x no demostr&#243; asociaciones significativas con la uve&#237;tis de Beh&#231;et&#46; Adem&#225;s&#44; empleamos c&#225;lculos de valor predictivo positivo &#40;PcPPV&#41; corregido por prevalencia para evaluar la utilidad cl&#237;nica de las pruebas de estos alelos dentro de la poblaci&#243;n iran&#237; de pacientes con uve&#237;tis de Beh&#231;et&#46; Se determin&#243; que el PcPPV para la prueba del genotipo B27&#47;x era del 0&#44;05&#37;&#44; mientras que el PcPPV para la prueba del genotipo B51&#58;01&#47;x en la misma poblaci&#243;n fue del 0&#44;065&#37;&#46; Estos resultados sugieren que los portadores del alelo B&#42;51&#58;01&#44; cuando presentan s&#237;ntomas cl&#237;nicos&#44; presentan un mayor riesgo de padecer uve&#237;tis de Beh&#231;et en comparaci&#243;n con la poblaci&#243;n general&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusi&#243;n</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Las personas portadoras del alelo B51&#58;01&#44; cuando presentan s&#237;ntomas&#44; enfrentan un riesgo elevado de uve&#237;tis de Beh&#231;et&#46; Esta informaci&#243;n ayuda en evaluaciones cl&#237;nicas espec&#237;ficas para poblaciones en riesgo&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Antecedentes"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:3 [
        "etiqueta" => "&#9674;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0005"><span class="elsevierStyleInterRef" id="intr0005" href="https://www.researchgate.net/profile/Mahdi_Zamani4">https&#58;&#47;&#47;www&#46;researchgate&#46;net&#47;profile&#47;Mahdi&#95;Zamani4</span>&#46;</p>"
        "identificador" => "fn0005"
      ]
    ]
    "multimedia" => array:6 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 571
            "Ancho" => 1025
            "Tamanyo" => 43328
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Examples of B&#42;51&#58;01 and B&#42;27 locus-specific typing results&#46; DNA ladder &#40;Orange Ruler 50bp DNA Ladder&#44; CinnaGen&#44; Iran&#41;&#59; &#40;1&#41; positive patient and &#40;2&#41; positive control &#40;3&#41; for B&#42;27 allele&#59; positive patient&#44; &#40;4&#41; positive control &#40;5&#44; 6&#41; for B&#42;51&#58;01 allele&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 956
            "Ancho" => 1025
            "Tamanyo" => 208935
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Sequence of HLA-B&#42;51&#58;01 allele&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence &#40;5&#8242;&#8211;3&#8242;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Size&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">B&#42;27&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCTACGTGGACGACACGCTCTCGGTCAGTCTGTGCCTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">149bp&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">B&#42;51&#58;01&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TACGCCTACGACGGCAAACTTCCCGTTCTCCAGGTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">183bp&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3715676.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Primer sequences for B&#42;51&#58;01 and B&#42;27 alleles&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Types uveitis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Patients &#40;fr&#41;<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>50&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Alleles&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Patients &#40;fr&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Posterior&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">29 &#40;58&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Posterior &#40;B5101&#43;&#41;Posterior &#40;B5101&#8722;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">27 &#40;93&#37;&#41;2 &#40;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Panuveitis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21 &#40;42&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Panuveitis &#40;B5101&#43;&#41;Panuveitis &#40;B5101&#8722;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;66&#37;&#41;7 &#40;34&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3715678.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">The distribution of the B&#42;51&#58;01 allele in different types of Behcet&#39;s uveitis&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Pv&#44; <span class="elsevierStyleItalic">P</span> value of the Fisher&#39;s exact test&#59; RR&#44; relative risks&#59; 95&#37;CL&#44; 95&#37;confidence limits of RR&#59; <span class="elsevierStyleItalic">N</span>&#44; number of patients&#59; PcPPV&#44; prevalence-corrected positive predictive value&#59; NS&#44; not significant&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">All BU patients</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Controls&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="3" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">All BU vs&#46; controls</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Pv&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">PcPPV&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">RR &#40;95&#37;Cl&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Genotypes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">N<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>50 &#40;fr&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">N<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>70 &#40;fr&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">B&#42;51&#58;01&#47;x&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">41 &#40;82&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">34 &#40;48&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;0001&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;065&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;76&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">B&#42;27&#47;x&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;05&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3715677.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">The distribution of B&#42;51&#58;01&#47;x and B&#42;27&#47;x genotype frequencies in total BU patients and controls&#46;</p>"
        ]
      ]
      5 => array:5 [
        "identificador" => "eq0005"
        "tipo" => "MULTIMEDIAFORMULA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Formula" => array:5 [
          "Matematica" => "PcPPV&#61;a&#40;a&#43;b&#41;&#61;&#40;PDT&#43;&#215;PD&#41;&#40;PDT&#43;&#215;PD&#41;&#43;&#91;PCT&#43;&#215;&#40;1&#8722;PD&#41;&#93;"
          "Fichero" => "STRIPIN_si1.jpeg"
          "Tamanyo" => 1846
          "Alto" => 24
          "Ancho" => 216
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:33 [
            0 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A Darwinian view of Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "R&#46; Smith"
                            1 => "R&#46;J&#46; Moots"
                            2 => "M&#46; Murad"
                            3 => "G&#46;R&#46; Wallace"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2478/rir-2021-0013"
                      "Revista" => array:6 [
                        "tituloSerie" => "Rheumatol Immunol Res"
                        "fecha" => "2021"
                        "volumen" => "2"
                        "paginaInicial" => "91"
                        "paginaFinal" => "99"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/36465976"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Adult Behcet&#39;s disease in Iran&#58; analysis of 6075 patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Davatchi"
                            1 => "C&#46; Chams-Davatchi"
                            2 => "H&#46; Shams"
                            3 => "A&#46; Nadji"
                            4 => "T&#46; Faezi"
                            5 => "M&#46; Akhlaghi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/1756-185X.12691"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Rheum Dis"
                        "fecha" => "2016"
                        "volumen" => "19"
                        "paginaInicial" => "95"
                        "paginaFinal" => "103"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26258691"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular genetics &#40;HLA&#41; of Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "N&#46; Mizuki"
                            1 => "H&#46; Inoko"
                            2 => "S&#46; Ohno"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3349/ymj.1997.38.6.333"
                      "Revista" => array:5 [
                        "tituloSerie" => "Yonsei Med J"
                        "fecha" => "1997"
                        "volumen" => "38"
                        "paginaInicial" => "333"
                        "paginaFinal" => "349"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Uveitis in Beh&#231;et disease&#58; an analysis of 880 patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "I&#46; Tugal-Tutkun"
                            1 => "S&#46; Onal"
                            2 => "R&#46; Altan-Yaycioglu"
                            3 => "H&#46;H&#46; Altunbas"
                            4 => "M&#46; Urgancioglu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ajo.2004.03.022"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Ophthalmol"
                        "fecha" => "2004"
                        "volumen" => "138"
                        "paginaInicial" => "373"
                        "paginaFinal" => "380"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15364218"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Understanding uveitis&#58; the impact of research on visual outcomes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;D&#46; de Smet"
                            1 => "S&#46;R&#46; Taylor"
                            2 => "B&#46; Bodaghi"
                            3 => "E&#46; Miserocchi"
                            4 => "P&#46;I&#46; Murray"
                            5 => "U&#46; Pleyer"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.preteyeres.2011.06.005"
                      "Revista" => array:6 [
                        "tituloSerie" => "Prog Retin Eye Res"
                        "fecha" => "2011"
                        "volumen" => "30"
                        "paginaInicial" => "452"
                        "paginaFinal" => "470"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21807112"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Immunopathogenesis of ocular Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "U&#46;C&#46; Park"
                            1 => "T&#46;W&#46; Kim"
                            2 => "H&#46;G&#46; Yu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.preteyeres.2011.06.005"
                      "Revista" => array:3 [
                        "tituloSerie" => "J Immunol Res"
                        "fecha" => "2014"
                        "paginaInicial" => "2014"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "New insights into the pathogenesis of Behcet&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46;P&#46; de Chambrun"
                            1 => "B&#46; Wechsler"
                            2 => "G&#46; Geri"
                            3 => "P&#46; Cacoub"
                            4 => "D&#46; Saadoun"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.autrev.2011.11.026"
                      "Revista" => array:5 [
                        "tituloSerie" => "Autoimmunity Rev"
                        "fecha" => "2012"
                        "volumen" => "11"
                        "paginaInicial" => "687"
                        "paginaFinal" => "698"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The chicken B locus is a minimal essential major histocompatibility complex"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Kaufman"
                            1 => "S&#46; Milne"
                            2 => "T&#46;W&#46; G&#246;bel"
                            3 => "B&#46;A&#46; Walker"
                            4 => "J&#46;P&#46; Jacob"
                            5 => "C&#46; Auffray"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/44856"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nature"
                        "fecha" => "1999"
                        "volumen" => "401"
                        "paginaInicial" => "923"
                        "paginaFinal" => "925"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10553909"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Immunopathogenesis of Behcet&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "B&#46; Tong"
                            1 => "X&#46; Liu"
                            2 => "J&#46; Xiao"
                            3 => "G&#46; Su"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fimmu.2019.00665"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Immunol"
                        "fecha" => "2019"
                        "volumen" => "10"
                        "paginaInicial" => "665"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30984205"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The association of Beh&#231;et&#39;s syndrome with HLA-B51 as understood in 2021"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46; Takeno"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/BOR.0000000000000846"
                      "Revista" => array:5 [
                        "tituloSerie" => "Curr Opin Rheumatol"
                        "fecha" => "2022"
                        "volumen" => "34"
                        "paginaInicial" => "4"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34690278"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Human MHC architecture and evolution&#58; implications for disease association studies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "J&#46; Traherne"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1744-313X.2008.00765.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Immunogenet"
                        "fecha" => "2008"
                        "volumen" => "35"
                        "paginaInicial" => "179"
                        "paginaFinal" => "192"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18397301"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HLA-B51 subtypes in Turkish patients with Behcet&#39;s disease and their correlation with clinical manifestations"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46;D&#46; Demirseren"
                            1 => "G&#46; Ceylan"
                            2 => "G&#46; Akoglu"
                            3 => "S&#46; Emre"
                            4 => "S&#46; Erten"
                            5 => "A&#46; Arman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4238/2014.July.2.8"
                      "Revista" => array:5 [
                        "tituloSerie" => "Genet Molec Res"
                        "fecha" => "2014"
                        "volumen" => "13"
                        "paginaInicial" => "4788"
                        "paginaFinal" => "4796"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HLA-B51 and its allelic types in association with Beh&#231;et&#39;s disease and recurrent aphthous stomatitis in Korea"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Chang"
                            1 => "J&#46; Kim"
                            2 => "K&#46; Cheon"
                            3 => "H&#46; Chung"
                            4 => "K&#46; Lee"
                            5 => "I&#46; Lee"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Clin Exp Rheumatol"
                        "fecha" => "2001"
                        "volumen" => "19"
                        "numero" => "Suppl&#46;&#47;24"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HLA-B&#42; 51 and Beh&#231;et disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46; Gul"
                            1 => "S&#46; Ohno"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/09273948.2011.634978"
                      "Revista" => array:5 [
                        "tituloSerie" => "Ocular Immunol Inflamm"
                        "fecha" => "2012"
                        "volumen" => "20"
                        "paginaInicial" => "37"
                        "paginaFinal" => "43"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genome-wide association analysis identifies new susceptibility loci for Behcet&#39;s disease and epistasis between HLA-B&#42; 51 and ERAP1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Kirino"
                            1 => "G&#46; Bertsias"
                            2 => "Y&#46; Ishigatsubo"
                            3 => "N&#46; Mizuki"
                            4 => "I&#46; Tugal-Tutkun"
                            5 => "E&#46; Seyahi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/ng.2520"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Genet"
                        "fecha" => "2013"
                        "volumen" => "45"
                        "paginaInicial" => "202"
                        "paginaFinal" => "207"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23291587"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The immunogenetics of Beh&#231;et&#39;s disease&#58; a comprehensive review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Takeuchi"
                            1 => "D&#46;L&#46; Kastner"
                            2 => "E&#46;F&#46; Remmers"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaut.2015.08.013"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Autoimmunity"
                        "fecha" => "2015"
                        "volumen" => "64"
                        "paginaInicial" => "137"
                        "paginaFinal" => "148"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "HLA-B-5101 in Greek patients with Behcet&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Koumantaki"
                            1 => "C&#46; Stavropoulos"
                            2 => "M&#46; Spyropoulou"
                            3 => "H&#46; Messini"
                            4 => "M&#46; Papademetropoulos"
                            5 => "E&#46; Giziaki"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s0198-8859(98)00011-1"
                      "Revista" => array:6 [
                        "tituloSerie" => "Hum Immunol"
                        "fecha" => "1998"
                        "volumen" => "59"
                        "paginaInicial" => "250"
                        "paginaFinal" => "255"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9568801"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Human leukocyte antigen B27 and B51 double-positive Beh&#231;et uveitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46;K&#46; Ahn"
                            1 => "Y&#46;G&#46; Park"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1001/archopht.125.10.1375"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Ophthalmol"
                        "fecha" => "2007"
                        "volumen" => "125"
                        "paginaInicial" => "1375"
                        "paginaFinal" => "1380"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17923546"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Reevaluation of the importance of polymorphic HLA class II alleles and amino acids in the susceptibility of individuals of different populations to type I diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; Zamani"
                            1 => "J&#46;J&#46; Cassiman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/(sici)1096-8628(19980305)76:2<183::aid-ajmg12>3.0.co;2-h"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Med Genet"
                        "fecha" => "1998"
                        "volumen" => "76"
                        "paginaInicial" => "183"
                        "paginaFinal" => "194"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9511982"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A strong association between HLA-B&#42; 5101 and Beh&#231;et&#39;s disease in Greek patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46; Mizukl"
                            1 => "S&#46; Ohno"
                            2 => "H&#46; Ando"
                            3 => "L&#46; Chen"
                            4 => "G&#46; Palimeris"
                            5 => "E&#46; Stavropoulos-Ghiokas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1399-0039.1997.tb02835.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Tissue Antigens"
                        "fecha" => "1997"
                        "volumen" => "50"
                        "paginaInicial" => "57"
                        "paginaFinal" => "60"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9243757"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Behcet&#39;s disease in Iran&#58; analysis of 6500 cases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Davatchi"
                            1 => "F&#46; Shahram"
                            2 => "C&#46; Chams-Davatchi"
                            3 => "H&#46; Shams"
                            4 => "A&#46; Nadji"
                            5 => "M&#46; Akhlaghi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1756-185X.2010.01549.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Rheum Dis"
                        "fecha" => "2010"
                        "volumen" => "13"
                        "paginaInicial" => "367"
                        "paginaFinal" => "373"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21199472"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Beh&#231;et syndrome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S&#46; Yurdakul"
                            1 => "V&#46; Hamuryudan"
                            2 => "H&#46; Yazici"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/00002281-200401000-00008"
                      "Revista" => array:6 [
                        "tituloSerie" => "Curr Opin Rheumatol"
                        "fecha" => "2004"
                        "volumen" => "16"
                        "paginaInicial" => "38"
                        "paginaFinal" => "42"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14673387"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Beh&#231;et&#39;s disease physiopathology&#58; a contemporary review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;J&#46; Zeidan"
                            1 => "D&#46; Saadoun"
                            2 => "M&#46; Garrido"
                            3 => "D&#46; Klatzmann"
                            4 => "A&#46; Six"
                            5 => "P&#46; Cacoub"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s13317-016-0074-1"
                      "Revista" => array:5 [
                        "tituloSerie" => "Autoimmun Highlights"
                        "fecha" => "2016"
                        "volumen" => "7"
                        "paginaInicial" => "1"
                        "paginaFinal" => "12"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Pathogenesis of Beh&#231;et&#39;s syndrome&#58; genetic&#44; environmental and immunological factors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "I&#46; Mattioli"
                            1 => "A&#46; Bettiol"
                            2 => "G&#46; Saruhan-Direskeneli"
                            3 => "H&#46; Direskeneli"
                            4 => "G&#46; Emmi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fmed.2021.713052"
                      "Revista" => array:4 [
                        "tituloSerie" => "Front Med"
                        "fecha" => "2021"
                        "volumen" => "8"
                        "paginaInicial" => "713052"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Etiology&#44; Immunopathogenesis and Biomarkers in Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "F&#46; Adeeb"
                            1 => "M&#46;U&#46; Khan"
                            2 => "A&#46;G&#46; Stack"
                            3 => "A&#46;D&#46; Fraser"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.5772/intechopen.68342"
                      "Revista" => array:2 [
                        "tituloSerie" => "Beh&#231;et&#39;s Dis"
                        "fecha" => "2017"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An update on the contribution of the MHC to AS susceptibility"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "J&#46;D&#46; Reveille"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10067-014-2662-7"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Rheumatol"
                        "fecha" => "2014"
                        "volumen" => "33"
                        "paginaInicial" => "749"
                        "paginaFinal" => "757"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24838411"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An HLA-C amino-acid variant in addition to HLA-B&#42; 27 confers risk for ankylosing spondylitis in the Korean population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; Kim"
                            1 => "S&#46;-Y&#46; Bang"
                            2 => "S&#46; Lee"
                            3 => "H&#46;-S&#46; Lee"
                            4 => "S&#46;-C&#46; Shim"
                            5 => "Y&#46;M&#46; Kang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s13075-015-0855-3"
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Res Therapy"
                        "fecha" => "2015"
                        "volumen" => "17"
                        "paginaInicial" => "1"
                        "paginaFinal" => "6"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Frequency of HLA-B5&#44; HLA-B51 and HLA-B27 in patients with idiopathic uveitis and Beh&#231;et&#39;s disease&#58; a case-control study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46; Shenavandeh"
                            1 => "K&#46;A&#46; Jahanshahi"
                            2 => "E&#46; Aflaki"
                            3 => "A&#46; Tavassoli"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.5114/reum.2018.75516"
                      "Revista" => array:6 [
                        "tituloSerie" => "Reumatologia"
                        "fecha" => "2018"
                        "volumen" => "56"
                        "paginaInicial" => "67"
                        "paginaFinal" => "72"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29853720"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular dynamics simulations provide molecular insights into the role of HLA-B51 in Beh&#231;et&#39;s disease pathogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Gur"
                            1 => "M&#46; Golcuk"
                            2 => "A&#46; Gul"
                            3 => "B&#46; Erman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/cbdd.13658"
                      "Revista" => array:6 [
                        "tituloSerie" => "Chem Biol Drug Des"
                        "fecha" => "2020"
                        "volumen" => "96"
                        "paginaInicial" => "644"
                        "paginaFinal" => "658"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32691964"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Is Beh&#231;et&#39;s disease a &#8216;class 1-opathy&#8217;&#63; The role of HLA-B&#42; 51 in the pathogenesis of Beh&#231;et&#39;s disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Giza"
                            1 => "D&#46; Koftori"
                            2 => "L&#46; Chen"
                            3 => "P&#46; Bowness"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/cei.13049"
                      "Revista" => array:5 [
                        "tituloSerie" => "Clin Exp Immunol"
                        "fecha" => "2018"
                        "volumen" => "191"
                        "paginaInicial" => "11"
                        "paginaFinal" => "18"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Behcet disease-associated MHC class I residues implicate antigen binding and regulation of cell-mediated cytotoxicity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;J&#46; Ombrello"
                            1 => "Y&#46; Kirino"
                            2 => "P&#46;I&#46; de Bakker"
                            3 => "A&#46; G&#252;l"
                            4 => "D&#46;L&#46; Kastner"
                            5 => "E&#46;F&#46; Remmers"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.1406575111"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2014"
                        "volumen" => "111"
                        "paginaInicial" => "8867"
                        "paginaFinal" => "8872"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24821759"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The Bw4 public epitope of HLA-B molecules confers reactivity with natural killer cell clones that express NKB1&#44; a putative HLA receptor"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46;E&#46; Gumperz"
                            1 => "V&#46; Litwin"
                            2 => "J&#46;H&#46; Phillips"
                            3 => "L&#46;L&#46; Lanier"
                            4 => "P&#46; Parham"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1084/jem.181.3.1133"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Exp Med"
                        "fecha" => "1995"
                        "volumen" => "181"
                        "paginaInicial" => "1133"
                        "paginaFinal" => "1144"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7532677"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Beh&#231;et&#39;s disease&#58; do natural killer cells play a significant role&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "H&#46; Petrushkin"
                            1 => "M&#46;S&#46; Hasan"
                            2 => "M&#46;R&#46; Stanford"
                            3 => "F&#46; Fortune"
                            4 => "G&#46;R&#46; Wallace"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fimmu.2015.00134"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Immunol"
                        "fecha" => "2015"
                        "volumen" => "6"
                        "paginaInicial" => "134"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25852697"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack786944"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="par0145" class="elsevierStylePara elsevierViewall">We gratefully acknowledge patients with BU and healthy volunteers who&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/1699258X/0000002000000009/v1_202411050519/S1699258X24000792/v1_202411050519/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "17499"
    "tipo" => "SECCION"
    "es" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "es"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/1699258X/0000002000000009/v1_202411050519/S1699258X24000792/v1_202411050519/en/main.pdf?idApp=UINPBA00004M&text.app=https://reumatologiaclinica.org/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1699258X24000792?idApp=UINPBA00004M"
]
Compartir
Información de la revista
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Original article
HLA-B*51:01 in Iranian patients with Behcet uveitis syndrome
HLA B51 en pacientes iraníes con uveítis en contexto de síndrome de Behçet
Zahra Hoseinia, Fatemeh Rezaei Rada, Mohammad Zareib, Nazanin Ebrahimiadibc, Zahra Salimiana, Mahdi Zamania,,
Autor para correspondencia
mzamani@tums.ac.ir

Corresponding author.
a Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran
b Farabi Eye Hospital, Tehran University of Medical Sciences, Tehran, Iran
c Department of Ophthalmology, University of Florida, Gainesville, FL, USA

Comprar documento

Para la compra de este documento es necesario que rellene el siguiente formulario:

Afganistan
Albania
Alemania
Andorra
Angola
Anguilla
Antartica
Antigua and barbuda
Antillas holandesas
Arabia saudita
Argelia
Argentina
Armenia
Aruba
Australia
Austria
Azerbaijan
Bahamas
Bahrain
Bangladesh
Barbados
Belarus
Belgica
Belice
Benin
Bermudas/antillas britanicas
Bhutan
Bolivia
Bosnia y herzegowina
Botswana
Brasil
Brunei darussalam
Bulgaria
Burkina faso
Burundi
Cabo verde
Camboya
Camerun
Canada
Chad
Chile
China
Chipre
Colombia
Comoros
Corea
Costa rica
Cote d´ivoire
Croacia
Cuba
Dinamarca
Djibouti
Dominica
East timor
Ecuador
Egipto
El salvador
Emiratos arabes unidos
Eritrea
Escocia
Eslovaquia
Eslovenia
España
Estados federados de micronesia
Estados unidos
Estonia
Etiopia
Fiji
Filipinas
Finlandia
Francia
Gabon
Gambia
Georgia
Ghana
Gibraltar
Grecia
Grenada
Groenlandia
Guadalupe
Guam
Guatemala
Guayana britanica
Guinea
Guinea ecuatorial
Guinea francesa
Guinea-bissau
Haiti
Holanda
Honduras
Hong kong
Hungria
India
Indonesia
Irak
Iran
Irlanda
Isla bouvet
Isla cocos (keeling)
Isla cook
Isla mauricio
Isla navidad
Isla norfolk
Islandia
Islas caiman
Islas falkland (malvinas)
Islas faroe
Islas georgia del sur y sandwich
Islas heard and mc donald
Islas marshall
Islas northern mariana
Islas salomon
Islas svalbard and jan mayen
Islas turks and caicos
Islas united states minor outlyi
Islas virgenes (britanicas)
Islas virgenes (u.s.a.)
Islas wallis and futuna
Israel
Italia
Jamaica
Japon
Jordania
Kazakhstan
Kenia
Kiribati
Kuwait
Kyrgyzstan
Lesoto
Letonia
Libano
Liberia
Libia arab jamahiriya
Liechtenstein
Lituania
Luxemburgo
Macao
Macedonia
Madagascar
Malasia
Malawi
Maldives
Mali
Malta
Marruecos
Martinica
Mauritania
Mayotte
Mexico
Monaco
Mongolia
Monserrat
Morocco
Mozambique
Myanmar
Namibia
Nauru
Nepal
Nicaragua
Niger
Nigeria
Niue
Noruega
Nueva caledonia
Nueva zelanda
Oman
Pakistan
Palau
Panama
Papua new guinea
Paraguay
Peru
Pitcairn
Polinesia francesa
Polonia
Portugal
Posesiones gran bretaña
Posesiones u.s.a.
Puerto rico
Qatar
Reino unido
Republica checa
Republica de africa central
Republica de cabo verde
Republica de congo
Republica de corea
Republica de moldova
Republica democratica de laos
Republica democratica del congo
Republica dominicana
Reunion
Ruanda
Rumania
Rusia
Sahara occidental
Saint kitts and nevis
Samoa
Samoa americana
San marino
San tomas y principe
San vincent and the grenadines
Santa lucia
Senegal
Serbia
Seychelles
Sierra leona
Singapur
Siria
Somalia
Sri lanka
St. helena
St. pierre and miquelon
Sudafrica
Sudan
Suecia
Suiza
Surinam
Swaziland
Tailandia
Taiwan republica de china
Tajikistan
Tanzania
Territorio de indias britanicas
Togo
Tokelau
Tonga
Trinidad and tobago
Tunisia
Turkmenistan
Turquia
Tuvalu
Ucrania
Uganda
Uruguay
Uzbekistan
Vanuatu
Vaticano
Venezuela
Vietnam
Yemen
Yugoslavia
Zambia
Zimbawe
Lebanon
Paises bajos
A coruña
Alava
Albacete
Alicante
Almeria
Asturias
Avila
Badajoz
Balears
Barcelona
Bizkaia
Burgos
Caceres
Cadiz
Cantabria
Castellon
Ceuta
Ciudad real
Cordoba
Cuenca
Girona
Granada
Guadalajara
Guipuzcoa
Huelva
Huesca
Jaen
La rioja
Las palmas
Leon
Lleida
Lugo
Madrid
Malaga
Melilla
Murcia
Navarra
Ourense
Palencia
Pontevedra
Salamanca
Segovia
Sevilla
Soria
Tarragona
Tenerife
Teruel
Toledo
Valencia
Valladolid
Zamora
Zaragoza
-- No procede --
Deseo recibir información sobre productos y promociones especiales de Elsevier por correo electrónico
Deseo recibir información sobre productos y promociones especiales de los partners de Elsevier por correo electrónico
* Campos obligatorios
Además del acceso temporal al documento, este le será enviado por correo electrónico.
Atención al cliente
Teléfono
Llamadas desde España
932 415 960
Llamadas desde el extranjero
+34 932 415 960
Horario de 9 a 18h. excepto los meses de julio y agosto que será de 9 a 15h.
Idiomas
Reumatología Clínica
es en

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?